Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU055701

Sigma-Aldrich

MISSION® esiRNA

targeting human NPY

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTCGCCCGACAGCATAGTACTTGCCGCCCAGCCACGCCCGCGCGCCAGCCACCATGCTAGGTAACAAGCGACTGGGGCTGTCCGGACTGACCCTCGCCCTGTCCCTGCTCGTGTGCCTGGGTGCGCTGGCCGAGGCGTACCCCTCCAAGCCGGACAACCCGGGCGAGGACGCACCAGCGGAGGACATGGCCAGATACTACTCGGCGCTGCGACACTACATCAACCTCATCACCAGGCAGAGATATGGAAAACGATCCAGCCCAGAGACACTGATTTCAGACCTCTTGATGAGAGAAAGCACAGAAAATGTTCCCAGAACTCGGCTTGAAGACCCTGCAATGTGGTGATGGGAAATGAGACTTGCTCTCTGGCCTTTTCCTA

N° accesso Ensembl | uomo

ENSG00000122585

N° accesso NCBI

NM_000905

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... NPY(4852) , NPY(4852)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Cheni-Chery Sudhakumari et al.
General and comparative endocrinology, 251, 54-65 (2017-03-23)
Neuropeptide-Y (NPY) has diverse physiological functions which are extensively studied in vertebrates. However, regulatory role of NPY in relation to brain ontogeny and recrudescence with reference to reproduction is less understood in fish. Present report for the first time evaluated
Claire B de La Serre et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 311(5), R930-R939 (2016-11-03)
Increased neuropeptide Y (NPY) gene expression in the dorsomedial hypothalamus (DMH) has been shown to cause hyperphagia, but the pathway underlying this effect remains less clear. Hypothalamic neural systems play a key role in the control of food intake, in
Sung-Hyeok Hong et al.
Oncotarget, 6(9), 7151-7165 (2015-02-26)
Ewing sarcoma (ES) develops in bones or soft tissues of children and adolescents. The presence of bone metastases is one of the most adverse prognostic factors, yet the mechanisms governing their formation remain unclear. As a transcriptional target of EWS-FLI1
Min Hee Park et al.
The EMBO journal, 34(12), 1648-1660 (2015-04-29)
Many reports have revealed the importance of the sympathetic nervous system (SNS) in the control of the bone marrow environment. However, the specific role of neuropeptide Y (NPY) in this process has not been systematically studied. Here we show that

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.