Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU050541

Sigma-Aldrich

MISSION® esiRNA

targeting human FSCN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCTGTCTGCCAATCAGGACGAGGAGACCGACCAGGAGACCTTCCAGCTGGAGATCGACCGCGACACCAAAAAGTGTGCCTTCCGTACCCACACGGGCAAGTACTGGACGCTGACGGCCACCGGGGGCGTGCAGTCCACCGCCTCCAGCAAGAATGCCAGCTGCTACTTTGACATCGAGTGGCGTGACCGGCGCATCACACTGAGGGCGTCCAATGGCAAGTTTGTGACCTCCAAGAAGAATGGGCAGCTGGCCGCCTCGGTGGAGACAGCAGGGGACTCAGAGCTCTTCCTCATGAAGCTCATCAACCGCCCCATCATCGTGTTCCGCGGGGAGCATGGCTTCATCGGCTGCCGCAAGGTCACGGGCACCCTGGACGCCAACCGCTCCAGCTATGACGTCTTCCAGCTGGAGTTCAACGATGGCGCCTACAACATCAAAGACTCCACAGGCA

N° accesso Ensembl | uomo

ENSG00000075618

N° accesso NCBI

NM_003088

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FSCN1(6624) , FSCN1(6624)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wei Gao et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 27(2), 365-379 (2018-10-21)
Laryngeal squamous cell carcinoma (LSCC) is a common form of head and neck cancer with poor prognosis. However, the mechanism underlying the pathogenesis of LSCC remains unclear. Here, we demonstrated increased expression of fascin actin-bundling protein 1 (FSCN1) and decreased
Priscila Campioni Rodrigues et al.
Oncotarget, 8(43), 74736-74754 (2017-11-02)
Oral squamous cell carcinoma (OSCC) prognosis is related to clinical stage and histological grade. However, this stratification needs to be refined. We conducted a comparative proteome study in microdissected samples from normal oral mucosa and OSCC to identify biomarkers for
Sean McGuire et al.
Gynecologic oncology, 153(2), 405-415 (2019-02-25)
Ovarian cancer (OvCa) metastasis requires the coordinated motility of both cancer and stromal cells. Cellular movement is a dynamic process that involves the synchronized assembly of f-actin bundles into cytoskeletal protrusions by fascin. Fascin directly binds f-actin and is an
Aihua Luo et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 73, 75-79 (2015-07-28)
Fascin actin-bundling protein 1 (FSCN1) plays significant roles in biological processes such as tumor cell invasion and metastasis. However, little is known about prognostic value of FSCN1 in non-small cell lung cancer (NSCLC). FSCN1 mRNA and protein expression were detected
Sunil Acharya et al.
Cancer research, 79(16), 4211-4226 (2019-06-27)
Triple-negative breast cancer (TNBC) is the most aggressive breast cancer subtype. To identify TNBC therapeutic targets, we performed integrative bioinformatics analysis of multiple breast cancer patient-derived gene expression datasets and focused on kinases with FDA-approved or in-pipeline inhibitors. Sphingosine kinase
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.