Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU050501

Sigma-Aldrich

MISSION® esiRNA

targeting human SGPL1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGTATTCATTTCTGCATCACATTACTACACGCCCGGAAACGAGTAGCTATACAATTCCTAAAGGACATTCGAGAATCTGTCACTCAAATCATGAAGAATCCTAAAGCGAAGACCACAGGAATGGGTGCCATCTATGGCATGGCCCAGACAACTGTTGACAGGAATATGGTTGCAGAATTGTCCTCAGTCTTCTTGGACAGCTTGTACAGCACCGACACTGTCACCCAGGGCAGCCAGATGAATGGTTCTCCAAAACCCCACTGAACTTGGACCCTTTCTAGTCTCAAGGGGATTCCAGCCTTCAGAAGGTTCTTGGGATATGGAACAGGCCGTGCACAACTTTGACATCTGGTCTTGCTCCATAGAGCACAACTCAAGATAGACCATGAGACAGCTTGAGCCTCAGG

N° accesso Ensembl | uomo

ENSG00000166224

N° accesso NCBI

NM_003901

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SGPL1(8879) , SGPL1(8879)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BQU
KJS
PET

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yuxuan Zhen et al.
Journal of autoimmunity, 93, 37-44 (2018-06-14)
Glomerulonephritis (GN) is a typical lesion in autoantibody and immune complex disorders, including SLE. Because the Gas6/Axl pathway has been implicated in the pathogenesis of many types of GN, targeting this pathway might ameliorate GN. Consequently, we have studied the
Pan-Feng Feng et al.
Molecular pharmaceutics, 16(4), 1477-1488 (2019-02-27)
The hERG potassium channel (IKr) encoded by human ether-a-go-go-related gene plays an important role in cardiac repolarization. Decreased IKr may lead to long QT syndrome, which subsequently causes torsade de pointes and sudden cardiac death. Previous studies have shown that
Haifei Wang et al.
Genes & genetic systems, 93(5), 191-198 (2018-11-27)
DNA methylation is an important mediator of gene expression regulation and has been shown to be closely linked to aging. Immune-related genes tend to be influenced by DNA methylation at different ages. To explore DNA methylation changes in the porcine
Rui Yamaguchi et al.
Cytokine, 108, 24-36 (2018-03-21)
The stimuli inducing expression of single immunoglobulin IL-1-related receptor (SIGIRR) and the relevant regulatory mechanisms are not well defined. Transforming growth factor β1 (TGFβ1) delays internalization of neurokinin-1 receptor (NK1R) and subsequently enhances cellular signaling. This study investigated the effect
Qiongying Hu et al.
Molecular medicine reports, 15(3), 1335-1342 (2017-01-19)
Osteosarcoma is the most common primary bone tumor characterized by high risk of metastasis, thus presents with an overall survival rate of 60%, despite the use of chemotherapy and surgery. Metastasis‑associated lung adenocarcinoma transcript 1 (MALAT‑1) has been reported to upregulated
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.