Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU049401

Sigma-Aldrich

MISSION® esiRNA

targeting human UCHL5

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Spedizione prevista il01 maggio 2025

Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Spedizione prevista il01 maggio 2025

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAACTTGCAGAGGAGGAACCCATGGATACAGATCAAGGTAATAGTATGTTAAGTGCTATTCAGTCAGAAGTTGCCAAAAATCAGATGCTTATTGAAGAAGAAGTACAGAAATTAAAAAGATACAAGATTGAGAATATCAGAAGGAAGCATAATTATCTGCCTTTCATTATGGAATTGTTAAAGACTTTAGCAGAACACCAGCAGTTAATACCACTAGTAGAAAAGGCAAAAGAAAAACAGAACGCAAAGAAAGCTCAGGAAACCAAATGAAGATGTTTTCAGATATGTACACATTTCTGCTTCTGCACATATTTTCATGGAAACCATTATGTATAAAGAACTTAGAGCAACATCCTAATTGGCTCAGTGCACGTTTGGCAATAGTGCCAGCCTGTCTTGTCT

N° accesso Ensembl | uomo

ENSG00000116750

N° accesso NCBI

NM_015984

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... UCHL5(51377) , UCHL5(51377)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
XZU
OWU
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Wonhee Han et al.
Scientific reports, 7, 42590-42590 (2017-02-16)
The Tcf/Lef family of transcription factors mediates the Wnt/β-catenin pathway that is involved in a wide range of biological processes, including vertebrate embryogenesis and diverse pathogenesis. Post-translational modifications, including phosphorylation, sumoylation and acetylation, are known to be important for the
Jieru Zhang et al.
Journal of Cancer, 11(22), 6675-6685 (2020-10-14)
Lung cancer is one of the most common malignant tumors in the world, with a high rate of malignancy and mortality. Seeking new biomarkers and potential drug targets is urgent for effective treatment of the disease. Deubiquitinase UCHL5/UCH37, as an
Susu Guo et al.
Cell death & disease, 12(1), 42-42 (2021-01-09)
The regulation of homeostasis in the Ubiquitin (Ub) proteasome system (UPS) is likely to be important for the development of liver cancer. Tribbles homolog 2 (TRIB2) is known to affect Ub E3 ligases (E3s) in liver cancer. However, whether TRIB2
Evangel Kummari et al.
PloS one, 10(8), e0135531-e0135531 (2015-08-13)
Although protein ubiquitination has been shown to regulate multiple processes during host response to Salmonella enterica serovar Typhimurium infection, specific functions of host deubiquitinating enzymes remain unknown in this bacterial infection. By using chemical proteomics approach, in which deubiquitinating enzymes

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.