Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU049051

Sigma-Aldrich

MISSION® esiRNA

targeting human XRN2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGATGCTAGTGCTCCTGGTGAAGGAGAACATAAAATCATGGATTACATTAGAAGGCAAAGAGCCCAGCCTAACCATGACCCAAATACTCATCATTGTTTATGTGGAGCAGATGCTGATCTCATTATGCTTGGCCTTGCCACACATGAACCGAACTTTACCATTATTAGAGAAGAATTCAAACCAAACAAGCCCAAACCATGTGGTCTTTGTAATCAGTTTGGACATGAGGTCAAAGATTGTGAAGGTTTGCCAAGAGAAAAGAAGGGAAAGCATGATGAACTTGCCGATAGTCTTCCTTGTGCAGAAGGAGAGTTTATCTTCCTTCGGCTTAATGTTCTTCGTGAGTATTTGGAAAGAGAACTCACAATGGCCAGCCTACCATTCACATTTGATGTTGAGAGGAGCATTGATGACTGGGTTTTCATGTGCTTCTTTGTGGGAAATGACTTCCTCC

N° accesso Ensembl | uomo

ENSG00000088930

N° accesso NCBI

NM_012255

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... XRN2(22803) , XRN2(22803)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Praveen L Patidar et al.
Scientific reports, 10(1), 14253-14253 (2020-08-30)
Persistent R-loops (RNA-DNA hybrids with a displaced single-stranded DNA) create DNA damage and lead to genomic instability. The 5'-3'-exoribonuclease 2 (XRN2) degrades RNA to resolve R-loops and promotes transcription termination. Previously, XRN2 was implicated in DNA double strand break (DSB)
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Jong-Sun Lee et al.
Molecular cell, 77(5), 1044-1054 (2020-01-12)
Antisense oligonucleotides (ASOs) that trigger RNase-H-mediated cleavage are commonly used to knock down transcripts for experimental or therapeutic purposes. In particular, ASOs are frequently used to functionally interrogate long noncoding RNAs (lncRNAs) and discriminate lncRNA loci that produce functional RNAs
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.