Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU046211

Sigma-Aldrich

MISSION® esiRNA

targeting human KIF2C

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTCGGGCTACTTTGGAATGTCATCCACTTACTATGACTGATCCTATCGAAGAGCACAGAATATGTGTCTGTGTTAGGAAACGCCCACTGAATAAGCAAGAATTGGCCAAGAAAGAAATTGATGTGATTTCCATTCCTAGCAAGTGTCTCCTCTTGGTACATGAACCCAAGTTGAAAGTGGACTTAACAAAGTATCTGGAGAACCAAGCATTCTGCTTTGACTTTGCATTTGATGAAACAGCTTCGAATGAAGTTGTCTACAGGTTCACAGCAAGGCCACTGGTACAGACAATCTTTGAAGGTGGAAAAGCAACTTGTTTTGCATATGGCCAGACAGGAAGTGGCAAGACACATACTATGGGCGGAGACCTCTCTGGGAAAGCCCAGAATGCATCCAAAGGGAT

N° accesso Ensembl | uomo

ENSG00000142945

N° accesso NCBI

NM_006845

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KIF2C(11004) , KIF2C(11004)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Haibo Wang et al.
Oncotarget, 8(30), 48671-48687 (2017-04-19)
Defects in resolving kinetochore-microtubule attachment mistakes during mitosis is linked to chromosome instability associated with carcinogenesis as well as resistance to cancer therapy. Here we report for the first time that tumor suppressor p53-binding protein 1 (53BP1) is phosphorylated at
Ashley Mooneyham et al.
Molecular cancer research : MCR, 17(2), 370-383 (2018-10-17)
UNC-45A, a highly conserved member of the UCS (UNC45A/CRO1/SHE4P) protein family of cochaperones, plays an important role in regulating cytoskeletal-associated functions in invertebrates and mammalian cells, including cytokinesis, exocytosis, cell motility, and neuronal development. Here, for the first time, UNC-45A
Chenyu Li et al.
Scientific reports, 6, 18773-18773 (2016-01-07)
Nucleolar and spindle-associated protein (NuSAP) is a microtubule-associated protein that functions as a microtubule stabiliser. Depletion of NuSAP leads to severe mitotic defects, however the mechanism by which NuSAP regulates mitosis remains elusive. In this study, we identify the microtubule
Rui-Chao Chai et al.
Carcinogenesis, 40(10), 1229-1239 (2019-06-04)
1p/19q codeletion, which leads to the abnormal expression of 1p19q genes in oligodendroglioma, is associated with chemosensitivity and favorable prognosis. Here, we aimed to explore the clinical implications of 1p19q gene expression in 1p/19q non-codel gliomas. We analyzed expression of
Hengyi Shao et al.
Scientific reports, 5, 12204-12204 (2015-07-25)
Chromosome segregation in mitosis is orchestrated by the dynamic interactions between the kinetochore and spindle microtubules. The microtubule depolymerase mitotic centromere-associated kinesin (MCAK) is a key regulator for an accurate kinetochore-microtubule attachment. However, the regulatory mechanism underlying precise MCAK depolymerase
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.