Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU043401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGTGGATGTGGATGTGTCCTCTGGCTTTATTTATTGGTGTGATTTTAGCAGCTCAGTGGCATCTGATAATGCGATCCGTAGAATTAAACCAGATGGATCTTCTCTGATGAACATTGTGACACATGGAATAGGAGAAAATGGAGTCCGGGGTATTGCAGTGGATTGGGTAGCAGGAAATCTTTATTTCACCAATGCCTTTGTTTCTGAAACACTGATAGAAGTTCTGCGGATCAATACTACTTACCGCCGTGTTCTTCTTAAAGTCACAGTGGACATGCCTAGGCATATTGTTGTAGATCCCAAGAACAGATACCTCTTCTGGGCTGACTATGGGCAGAGACCAAAGATTGAGCGTTCTTTCCTTGACTGTACCAATCGAACAGTGCTTGTGTCAGAGGGCATTGTC

N° accesso Ensembl | uomo

ENSG00000081479

N° accesso NCBI

NM_004525

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... LRP2(4036) , LRP2(4036)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
ITU
OLU
BCS
AXR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yuan Gao et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7684-7693 (2019-03-21)
Osteoblast differentiation of human mesenchymal stem cells (hMSCs) is stimulated by 1α,25-dihydroxycholecalciferol [1α,25(OH)2D3] and 25-hydroxycholecalciferol [25(OH)D3]; the latter's effects require intracellular hydroxylation to 1α,25(OH)2D3. Thus, hMSCs are both a source of and target for 1α,25(OH)2D3. Megalin is a transmembrane receptor
Rohit Upadhyay et al.
JCI insight, 5(14) (2020-06-17)
Free light chains (FLCs) induce inflammatory pathways in proximal tubule cells (PTCs). The role of TLRs in these responses is unknown. Here we present findings on the role of TLRs in FLC-induced PTC injury. We exposed human kidney PTC cultures
Aurélien Briens et al.
Cell discovery, 3, 17001-17001 (2017-04-19)
Plasminogen activation is involved in many processes within the central nervous system, including synaptic plasticity, neuroinflammation and neurodegeneration. However, the mechanisms that regulate plasminogen activation in the brain still remain unknown. Here we demonstrate that astrocytes participate in this regulation
Kimberly R Long et al.
American journal of physiology. Renal physiology, 318(3), F851-F859 (2020-02-19)
Albuminuria is frequently associated with proximal tubule (PT) cytotoxicity that can feed back to cause glomerular damage and exacerbate kidney disease. PT cells express megalin and cubilin receptors that bind to and internalize albumin over a broad concentration range. How
Jeanne L Theis et al.
eLife, 9 (2020-10-03)
Congenital heart diseases (CHDs), including hypoplastic left heart syndrome (HLHS), are genetically complex and poorly understood. Here, a multidisciplinary platform was established to functionally evaluate novel CHD gene candidates, based on whole-genome and iPSC RNA sequencing of a HLHS family-trio.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.