Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU035401

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL16

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATGCTTACTCGGGGATTGTGGCCCACCAGAAGCATTTACTTCCTACCAGCCCCCCAATTTCTCAGGCCTCAGAGGGGGCATCTTCAGATATCCACACCCCTGCCCAGATGCTCCTGTCCACCTTGCAGTCCACTCAGCGCCCCACCCTCCCAGTAGGATCACTGTCCTCGGACAAAGAGCTCACTCGTCCCAATGAAACCACCATTCACACTGCGGGCCACAGTCTGGCAGCTGGGCCTGAGGCTGGGGAGAACCAGAAGCAGCCGGAAAAAAATGCTGGTCCCACAGCCAGGACATCAGCCACAGTGCCAGTCCTGTGCCTCCTGGCCATCATCTTCATCCTCACCGCAGCCCTTTCCTATGTGCTGTGCAAGAGGAGGAGGGGGCAGTCACCGCAGTCCTCTCCAGATCTGCCGGTTCATTATATACCTGTGGCACCTGACTCTAATACCTGAGCCAAGAATGGAAGCTT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Non trovi il prodotto giusto?  

Prova il nostro Motore di ricerca dei prodotti.

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhenzhen Ma et al.
Respiratory research, 22(1), 42-42 (2021-02-08)
Alveolar epithelial cells play an essential role in the initiation and progression of pulmonary fibrosis, and the occurrence of epithelial-mesenchymal transition (EMT) may be the early events of pulmonary fibrosis. Recent studies have shown chemokines are involved in the complex
Kun Ling Ma et al.
American journal of translational research, 10(6), 1802-1816 (2018-07-19)
Non-alcoholic fatty liver disease (NAFLD), characterised by early lipid accumulation and subsequent inflammation in the liver, is becoming a worldwide challenge due to its increasing prevalence in developing and developed countries. This study aimed to investigate the role of CXC
Audrey Dieudonné et al.
PloS one, 7(8), e41952-e41952 (2012-08-11)
Scavenger receptors and Toll-like receptors (TLRs) cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (ds)RNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed
Ze-Bo Hu et al.
Acta pharmacologica Sinica, 39(6), 1022-1033 (2018-04-06)
Inflammation and lipid disorders play crucial roles in synergistically accelerating the progression of diabetic nephropathy (DN). In this study we investigated how inflammation and lipid disorders caused tubulointerstitial injury in DN in vivo and in vitro. Diabetic db/db mice were
Yijie Zhang et al.
Pathology, research and practice, 216(5), 152913-152913 (2020-03-17)
CXC chemokine ligand 16 (CXCL16) has been reported to exacerbate acute kidney injury induced by ischemia-reperfusion (IR). This study aimed to investigate the probable role of CXCL16 in hepatic IR injury during liver transplantation. The expression patterns of CXCL16 and

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.