Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU035381

Sigma-Aldrich

MISSION® esiRNA

targeting human SGK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCCTTCTCCTCCACCAAGTCCTTCTCAGCAAATCAACCTTGGCCCGTCGTCCAATCCTCATGCTAAACCATCTGACTTTCACTTCTTGAAAGTGATCGGAAAGGGCAGTTTTGGAAAGGTTCTTCTAGCAAGACACAAGGCAGAAGAAGTGTTCTATGCAGTCAAAGTTTTACAGAAGAAAGCAATCCTGAAAAAGAAAGAGGAGAAGCATATTATGTCGGAGCGGAATGTTCTGTTGAAGAATGTGAAGCACCCTTTCCTGGTGGGCCTTCACTTCTCTTTCCAGACTGCTGACAAATTGTACTTTGTCCTAGACTACATTAATGGTGGAGAGTTGTTCTACCATCTCCAGAGGGAACGCTGCTTCCTGGAACCACGGGCTCGTTTCTATGCTGCTGAAATAGCCAGTG

N° accesso Ensembl | uomo

ENSG00000118515

N° accesso NCBI

NM_005627

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... SGK1(6446) , SGK1(6446)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Nadeshda Schelski et al.
Pflugers Archiv : European journal of physiology, 471(6), 889-899 (2019-02-02)
The serum- and glucocorticoid-inducible kinase 1 (SGK1) is a key regulator of osteo-/chondrogenic transdifferentiation and subsequent calcification of vascular smooth muscle cells (VSMCs). The phenotypical transdifferentiation of VSMCs is associated with increased interleukin-18 (IL-18) levels and generalized inflammation. Therefore, the
Florian Poetsch et al.
International journal of molecular sciences, 21(19) (2020-10-03)
In diabetes mellitus, hyperglycemia promotes the osteogenic transdifferentiation of vascular smooth muscle cells (VSMCs) to enhance medial vascular calcification, a common complication strongly associated with cardiovascular disease and mortality. The mechanisms involved are, however, still poorly understood. Therefore, the present
Jakob Voelkl et al.
The Journal of clinical investigation, 128(7), 3024-3040 (2018-06-12)
Medial vascular calcification, associated with enhanced mortality in chronic kidney disease (CKD), is fostered by osteo-/chondrogenic transdifferentiation of vascular smooth muscle cells (VSMCs). Here, we describe that serum- and glucocorticoid-inducible kinase 1 (SGK1) was upregulated in VSMCs under calcifying conditions.
Eneda Toska et al.
Cell reports, 27(1), 294-306 (2019-04-04)
The PI3K pathway integrates extracellular stimuli to phosphorylate effectors such as AKT and serum-and-glucocorticoid-regulated kinase (SGK1). We have previously reported that the PI3K pathway regulates estrogen receptor (ER)-dependent transcription in breast cancer through the phosphorylation of the lysine methyltransferase KMT2D
Ferran Medina-Jover et al.
FEBS letters, 594(19), 3200-3215 (2020-08-09)
BMP9 is a cytokine involved in the maturation phase of the angiogenic process that signals through its serine/threonine receptor ALK1 and its coreceptor endoglin. In this paper, we explain how BMP9 directs the regulation of endothelial cell proliferation blockage while
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.