Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU035311

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATCAGACTGTGCCTCAGGATTGTGTTGTGCTAGACACTTCTGGTCCAAGATCTGTAAACCTGTCCTGAAAGAAGGTCAAGTGTGTACCAAGCATAGGAGAAAAGGCTCTCATGGACTAGAAATATTCCAGCGTTGTTACTGTGGAGAAGGTCTGTCTTGCCGGATACAGAAAGATCACCATCAAGCCAGTAATTCTTCTAGGCTTCACACTTGTCAGAGACACTAAACCAGCTATCCAAATGCAGTGAACTCCTTTTATATAATAGATGCTATGAAAACCTTTTATGACCTTCATCAACTCAATCCTAAGGATATACAAGTTCTGTGGTTTCAGTTAAGCATTCCAATAACACCTTCCAAAAACCTGGAGTGTAAGAGCTTTGTTTCTTTATGGAACTCCCCTGTGATTG

N° accesso Ensembl | uomo

ENSG00000107984

N° accesso NCBI

NM_012242

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... DKK1(22943) , DKK1(22943)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ruirui Cheng et al.
Oncology reports, 37(4), 2129-2136 (2017-03-30)
The number of new lung cancer cases diagnosed yearly is high, and the mortality rate has not substantially declined. Non-small cell lung cancer (NSCLC) is the most common type of lung cancer, and adenocarcinoma accounts for the largest proportion of
Shusuke Ueda et al.
Medical molecular morphology, 48(2), 69-75 (2014-05-14)
Osteonecrosis is a major glucocorticoid-induced complication in the orthopedics field. Despite the extensive researches, mechanisms underlining the glucocorticoid-induced osteonecrosis are largely unknown. Here, we first provide the evidence that a combined treatment of cultured osteocytic cells with glucocorticoid and hypoxia
A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK
Hua Li et al.
Anti-cancer agents in medicinal chemistry, 18(14), 2010-2016 (2018-12-07)
Gastric adenocarcinoma is one of the most common and lethal cancer types and is known as the second leading cause of cancer-related death of Asian adults, early diagnosis based on either pathology or molecular biology could be one of the
Sandra Jumpertz et al.
Cellular signalling, 34, 38-46 (2017-02-24)
The COP9 signalosome (CSN) is a multi-protein complex that is highly conserved in eukaryotes. Due to its regulatory impact on processes such as cell cycle, DNA damage response and apoptosis, the CSN is essential for mammalian cells. One of the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.