Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU034841

Sigma-Aldrich

MISSION® esiRNA

targeting human FDXR

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51
Prezzi e disponibilità al momento non sono disponibili

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGGATTTCTTGGGTCTCCAGGACAAGATCAAGGAGGTCCCCCGCCCGAGGAAGCGGCTGACGGAACTGCTGCTTCGAACGGCCACAGAGAAGCCAGGGCCGGCGGAAGCTGCCCGCCAGGCATCGGCCTCCCGTGCCTGGGGCCTCCGCTTTTTCCGAAGCCCCCAGCAGGTGCTGCCCTCACCAGATGGGCGGCGGGCAGCAGGTGTCCGCCTAGCAGTCACTAGACTGGAGGGTGTCGATGAGGCCACCCGTGCAGTGCCCACGGGAGACATGGAAGACCTCCCTTGTGGGCTGGTGCTCAGCAGCATTGGGTATAAGAGCCGCCCTGTCGACCCAAGCGTGCCCTTTGACTCCAAGCTTGGGGTCATCCCCAATGTGGAGGGCCGGGTTATGGATGTGCCAGGCCTCTACTGCAGCGGCTGGGTGAAGAGAGGACCTACAGGTGTCATAGCCACAACCATGACTGACAGC

N° accesso Ensembl | uomo

ENSG00000161513

N° accesso NCBI

NM_004110

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FDXR(2232) , FDXR(2232)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS
DOR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

S H Akter et al.
Veterinary pathology, 52(6), 1027-1033 (2015-03-11)
Controversies remain regarding the cell type from which human prostate cancer originates, and many attempts have been made to identify the cellular origin of canine prostate cancer but without definitive proof. This study aims to evaluate the expression of luminal
Valerie N Barton et al.
Molecular cancer therapeutics, 14(3), 769-778 (2015-02-26)
Triple-negative breast cancer (TNBC) has the lowest 5-year survival rate of invasive breast carcinomas, and currently there are no approved targeted therapies for this aggressive form of the disease. The androgen receptor (AR) is expressed in up to one third
Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Fan Sun et al.
Journal of cellular physiology, 230(11), 2640-2646 (2015-02-03)
Adrenoreceptors (ARs) are widely expressed and play essential roles throughout the body. Different subtype adrenoceptors elicit distinct effects on cell proliferation, but knowledge remains scarce about the subtype-specific effects of β2-ARs on the proliferation of embryonic pluripotent stem (PS) cells
Visualizza tutti i documenti correlati

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.