Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU034721

Sigma-Aldrich

MISSION® esiRNA

targeting human LGALS1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTCTCGGGTGGAGTCTTCTGACAGCTGGTGCGCCTGCCCGGGAACATCCTCCTGGACTCAATCATGGCTTGTGGTCTGGTCGCCAGCAACCTGAATCTCAAACCTGGAGAGTGCCTTCGAGTGCGAGGCGAGGTGGCTCCTGACGCTAAGAGCTTCGTGCTGAACCTGGGCAAAGACAGCAACAACCTGTGCCTGCACTTCAACCCTCGCTTCAACGCCCACGGCGACGCCAACACCATCGTGTGCAACAGCAAGGACGGCGGGGCCTGGGGGACCGAGCAGCGGGAGGCTGTCTTTCCCTTCCAGCCTGGAAGTGTTGCAGAGGTGTGCATCACCTTCGACCAGGCCAACCTGACCGTCAAGCTGCCAGATGGATACGAATTCAAGTTCCCCAACCGCCTCAACCTGGAGGCCATCAACTACATGGCAGCTGACGGTGACTTCAAGATCAAATGTGTGGCCTTTGACTGAAA

N° accesso Ensembl | uomo

ENSG00000100097

N° accesso NCBI

NM_002305

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... LGALS1(3956) , LGALS1(3956)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS
XET
GCT
IRS
ANS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xue Zhu et al.
Acta biochimica et biophysica Sinica, 48(5), 462-467 (2016-03-31)
Carcinoma-associated fibroblasts (CAFs) play central roles in facilitating tumor progression and metastasis in breast cancer. Galectin-1 (Gal-1), a marker of CAFs, was previously reported to be associated with tumorigenesis and metastasis of various types of tumors. The aim of this
Dong Qian et al.
Cancer letters, 397, 43-51 (2017-03-25)
Galectin-1, mainly expressed in activated pancreatic stellate cells (PSCs), is involved in many important cancer-related processes. However, very little is known how Galectin-1 modulates PSCs and subsequently impacts pancreatic cancer cells (PCCs). Our chemokine antibody array and in vitro studies demonstrates
Noor Al-Obaidi et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(1), 373-387 (2018-07-06)
Chronic exposure of tubular renal cells to high glucose contributes to tubulointerstitial changes in diabetic nephropathy. In the present study, we identified a new fibrosis gene called galectin-1 (Gal-1), which is highly expressed in tubular cells of kidneys of type
Jie Zhu et al.
American journal of translational research, 11(6), 3862-3878 (2019-07-18)
It has been reported that Galectin-1 (Gal-1) indicates bad prognosis of patients with ovarian cancer, and Gal-1 overexpression promotes metastasis of ovarian cancer cells. Nevertheless, the underlying mechanisms of the Gal-1-mediated enhancement of metastasis are still unclear. Furthermore, little is
Neus Martínez-Bosch et al.
Cancer research, 74(13), 3512-3524 (2014-05-09)
Despite some advances, pancreatic ductal adenocarcinoma (PDAC) remains generally refractory to current treatments. Desmoplastic stroma, a consistent hallmark of PDAC, has emerged as a major source of therapeutic resistance and thus potentially promising targets for improved treatment. The glycan-binding protein
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.