Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU032851

Sigma-Aldrich

MISSION® esiRNA

targeting human CBL

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATCCTGGCTACATGGCTTTTTTGACGTATGACGAAGTGAAAGCTCGGCTCCAGAAATTCATTCACAAACCTGGCAGTTATATCTTCCGGCTGAGCTGTACTCGTCTGGGTCAGTGGGCTATTGGGTATGTTACTGCTGATGGGAACATTCTCCAGACAATCCCTCACAATAAACCTCTCTTCCAAGCACTGATTGATGGCTTCAGGGAAGGCTTCTATTTGTTTCCTGATGGACGAAATCAGAATCCTGATCTGACTGGCTTATGTGAACCAACTCCCCAAGACCATATCAAAGTGACCCAGGAACAATATGAATTATACTGTGAGATGGGCTCCACATTCCAACTATGTAAAATATGTGCTGAAAATGATAAGGATGTAAAGATTGAGCCCTGTGGACACCTCATGTGCACATCCTGTCTTACATCCTGGCAGGAATCAGAAGGTCAGGGCTGTCCTTTCTGCCGATGTGAAAT

N° accesso Ensembl | uomo

ENSG00000110395

N° accesso NCBI

NM_005188

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CBL(867) , CBL(867)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ying Hong et al.
Neurology. Genetics, 6(4), e448-e448 (2020-07-09)
To report a series of patients with cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma (CBL) gene and examine the functional role of the identified mutant Cbl protein. We hypothesized that mutated Cbl fails to act as
Shimei Chen et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 132, 110856-110856 (2020-10-31)
The incidence of retinopathy of prematurity (ROP) has increased continuously in recent years. However, the therapeutic effects of current treatments still remain undesired. This study aims to investigate the role of C-CBL in retinal angiogenesis in ROP and its potential
Chia-Hao Chang et al.
Oncotarget, 8(19), 31199-31214 (2017-04-19)
Post-translational mechanisms regulating cell-matrix adhesion turnover during cell locomotion are not fully elucidated. In this study, we uncovered an essential role of Y118 site-specific tyrosine phosphorylation of paxillin, an adapter protein of focal adhesion complexes, in paxillin recruitment to autophagosomes
Chirayu Pandya et al.
Psychoneuroendocrinology, 45, 108-118 (2014-05-23)
Brain derived neurotrophic factor (BDNF) signaling through its receptor TrkB plays a crucial role in neurodevelopment and plasticity. Stress and glucocorticoids have been shown to alter TrkB signaling in neurons, and defects in TrkB expression have been reported in the
Y Gui et al.
Oncogene, 34(46), 5718-5728 (2015-03-03)
Suppressor of cytokine signaling 1 (SOCS1) is considered as a tumor suppressor protein in hepatocellular carcinoma (HCC), but the underlying mechanisms remain unclear. Previously, we have shown that SOCS1-deficient hepatocytes displayed increased responsiveness to hepatocyte growth factor (HGF) due to

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.