Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU025951

Sigma-Aldrich

MISSION® esiRNA

targeting human AR

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGGAAGCTGCAAGGTCTTCTTCAAAAGAGCCGCTGAAGGGAAACAGAAGTACCTGTGCGCCAGCAGAAATGATTGCACTATTGATAAATTCCGAAGGAAAAATTGTCCATCTTGTCGTCTTCGGAAATGTTATGAAGCAGGGATGACTCTGGGAGCCCGGAAGCTGAAGAAACTTGGTAATCTGAAACTACAGGAGGAAGGAGAGGCTTCCAGCACCACCAGCCCCACTGAGGAGACAACCCAGAAGCTGACAGTGTCACACATTGAAGGCTATGAATGTCAGCCCATCTTTCTGAATGTCCTGGAAGCCATTGAGCCAGGTGTAGTGTGTGCTGGACACGACAACAACCAGCCCGACTCCTTTGCAGCCTTGCTCTCTAGCCTCAATGAACTGGGAGAGAGACAGCTTGTACACGTGGTCAAGTGGGCCAAGGCCTTGCCTGGCTTCCGCAACTTACACGTGGACGACCAGATGGCTGTCATTCA

N° accesso Ensembl | uomo

ENSG00000169083

N° accesso NCBI

NM_000044

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... AR(367) , AR(367)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Chenfei Wang et al.
Nature cell biology, 20(5), 620-631 (2018-04-25)
H3K9me3-dependent heterochromatin is a major barrier of cell fate changes that must be reprogrammed after fertilization. However, the molecular details of these events are lacking in early embryos. Here, we map the genome-wide distribution of H3K9me3 modifications in mouse early
Sekar Natesampillai et al.
Journal of immunology (Baltimore, Md. : 1950), 203(3), 718-724 (2019-06-14)
CD4 T cells from HIV-1 infected patients die at excessive rates compared to those from uninfected patients, causing immunodeficiency. We previously identified a dominant negative ligand that antagonizes the TRAIL-dependent pathway of cell death, which we called TRAILshort. Because the
Nathan R Zemke et al.
Cell host & microbe, 22(6), 789-800 (2017-12-15)
The N-terminal half of adenovirus e1a assembles multimeric complexes with host proteins that repress innate immune responses and force host cells into S-phase. In contrast, the functions of e1a's C-terminal interactions with FOXK, DCAF7, and CtBP are unknown. We found
Vasileios Chortis et al.
Endocrinology, 159(8), 2836-2849 (2018-06-01)
Adrenocortical carcinoma (ACC) is an aggressive malignancy with poor response to chemotherapy. In this study, we evaluated a potential new treatment target for ACC, focusing on the mitochondrial reduced form of NAD phosphate (NADPH) generator nicotinamide nucleotide transhydrogenase (NNT). NNT
Zuzana Krchnáková et al.
Nucleic acids research, 47(2), 911-928 (2018-11-18)
Many nascent long non-coding RNAs (lncRNAs) undergo the same maturation steps as pre-mRNAs of protein-coding genes (PCGs), but they are often poorly spliced. To identify the underlying mechanisms for this phenomenon, we searched for putative splicing inhibitory sequences using the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.