Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU024531

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP3K14

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACTGAGGACAACGAGGGTGTCCTGCTCACTGAGAAACTCAAGCCAGTGGATTATGAGTACCGAGAAGAAGTCCACTGGGCCACGCACCAGCTCCGCCTGGGCAGAGGCTCCTTCGGAGAGGTGCACAGGATGGAGGACAAGCAGACTGGCTTCCAGTGCGCTGTCAAAAAGGTGCGGCTGGAAGTATTTCGGGCAGAGGAGCTGATGGCATGTGCAGGATTGACCTCACCCAGAATTGTCCCTTTGTATGGAGCTGTGAGAGAAGGGCCTTGGGTCAACATCTTCATGGAGCTGCTGGAAGGTGGCTCCCTGGGCCAGCTGGTCAAGGAGCAGGGCTGTCTCCCAGAGGACCGGGCCCTGTACTACCTGGGCCAGGCCCTGGAGGGTCTGGAATACCTCCACTCACGAAGGATTCTGCA

N° accesso Ensembl | uomo

ENSG00000006062

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAP3K14(9020) , MAP3K14(9020)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Kislay Parvatiyar et al.
Nature communications, 9(1), 2770-2770 (2018-07-19)
Detection of viral genomes by the innate immune system elicits an antiviral gene program mediated by type I interferons (IFNs). While viral RNA and DNA species induce IFN via separate pathways, the mechanisms by which these pathways are differentially modulated
Miles C Duncan et al.
PloS one, 12(2), e0171406-e0171406 (2017-02-07)
Infection of human cells with Yersinia pseudotuberculosis expressing a functional type III secretion system (T3SS) leads to activation of host NF-κB. We show that the Yersinia T3SS activates distinct NF-κB pathways dependent upon bacterial subcellular localization. We found that wildtype
Po Y Mak et al.
British journal of haematology, 167(3), 376-384 (2014-08-01)
Overexpression of the apoptosis repressor with caspase recruitment domain (ARC, also termed NOL3) protein predicts adverse outcome in patients with acute myeloid leukaemia (AML) and confers drug resistance to AML cells. The second mitochondrial-derived activator of caspases (SMAC, also termed
Paulina Kucharzewska et al.
Journal of cell science, 132(7) (2019-03-07)
NF-κB-inducing kinase (NIK; also known as MAP3K14) is a central regulator of non-canonical NF-κB signaling in response to stimulation of TNF receptor superfamily members, such as the lymphotoxin-β receptor (LTβR), and is implicated in pathological angiogenesis associated with chronic inflammation
Katharina Mörs et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(1), 17-30 (2017-08-30)
Alcohol (ethanol, EtOH) as significant contributor to traumatic injury is linked to suppressed inflammatory response, thereby influencing clinical outcomes. Alcohol-induced immune-suppression during acute inflammation (trauma) was linked to nuclear factor-kappaB (NF-ĸB). Here, we analyzed alcohol`s effects and mechanisms underlying its
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.