Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU024211

Sigma-Aldrich

MISSION® esiRNA

targeting human XDH

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ATTTCCGCTGATGATGTTCCTGGGAGTAACATAACTGGAATTTGTAATGATGAGACAGTCTTTGCGAAGGATAAGGTTACTTGTGTTGGGCATATCATTGGTGCTGTGGTTGCTGACACCCCGGAACACACACAGAGAGCTGCCCAAGGGGTGAAAATCACCTATGAAGAACTACCAGCCATTATCACAATTGAGGATGCTATAAAGAACAACTCCTTTTATGGACCTGAGCTGAAGATCGAGAAAGGGGACCTAAAGAAGGGGTTTTCCGAAGCAGATAATGTTGTGTCAGGGGAGATATACATCGGTGGCCAAGAGCACTTCTACCTGGAGACTCACTGCACCATTGCTGTTCCAAAAGGCGAGGCAGGGGAGATGGAGCTCTTTGTGTCTACACAGAACACCATGAAGACCCAGAGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

G-L Chen et al.
Oncogenesis, 6(9), e382-e382 (2017-09-26)
Xanthine dehydrogenase (XDH), a rate-limiting enzyme involved in purine metabolism, has an essential role in inflammatory cascades. Researchers have known for decades that XDH activity is decreased in some cancers, including hepatocellular carcinoma (HCC). However, the role of XDH in
You-Jin Kim et al.
International journal of molecular sciences, 21(20) (2020-10-15)
In the present study, we investigated the effects of xanthine oxidase (XO) inhibition on cholesterol-induced renal dysfunction in chronic kidney disease (CKD) mice, and in low-density lipoprotein (LDL)-treated human kidney proximal tubule epithelial (HK-2) cells. ApoE knockout (KO) mice underwent
Se-Hyun Oh et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7301-7314 (2019-03-13)
Hypercholesterolemia is reported to increase reactive oxygen species (ROS) and to promote breast cancer progression. ROS play an important role in tumor biology, and xanthine oxidase (XO) is an enzyme that generates ROS. The effects of febuxostat (FBX), an XO
Haixia Xu et al.
Free radical biology & medicine, 139, 70-79 (2019-05-20)
The natural compound Alternol was shown to induce profound oxidative stress and apoptotic cell death preferentially in cancer cells. In this study, a comprehensive investigation was conducted to understand the mechanism for Alternol-induced ROS accumulation responsible for apoptotic cell death.
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.