Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

View All Documentation

EHU017501

Sigma-Aldrich

MISSION® esiRNA

targeting human CLDN1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGAGCAGCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAATCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGAAGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAGGTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATGACCCTATGACCCCAGTCAATGCCAGGTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGGAGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCCCTATCCAAAAC

N° accesso Ensembl | uomo

ENSG00000163347

N° accesso NCBI

NM_021101

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CLDN1(9076) , CLDN1(9076)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yi-Feng Zheng et al.
Journal of cellular biochemistry, 120(4), 6090-6105 (2018-12-07)
Colorectal carcinoma (CRC) is a major cause of cancer-related deaths worldwide, and investigations on novel targets are imperative. MiR-98 has been reported to act as a tumor suppressor in several cancers. To evaluate miR-98 as a novel anticancer molecule for
Trevor R Leonardo et al.
International journal of molecular sciences, 21(8) (2020-04-29)
Bicellular tight junctions are multiprotein complexes that are required for maintenance of barrier function and fence function in epithelial tissues. Wound healing in the oral cavity leads to minimal scar formation compared to the skin, and the precise mechanisms for
Francescopaolo Di Cello et al.
PloS one, 8(7), e68630-e68630 (2013-07-12)
Downregulation of the tight junction protein claudin 1 is a frequent event in breast cancer and is associated with recurrence, metastasis, and reduced survival, suggesting a tumor suppressor role for this protein. Tumor suppressor genes are often epigenetically silenced in
Jin Zhu et al.
Journal of translational medicine, 14(1), 166-166 (2016-06-10)
MicroRNAs have the potential as diagnostic biomarkers and therapeutic targets in autoimmune diseases. However, very limited studies have evaluated the expression of microRNA profile in thyroid gland related to Hashimoto's thyroiditis (HT). MicroRNA microarray expression profiling was performed and validated
Haruka Nasako et al.
International journal of molecular sciences, 21(16) (2020-08-23)
Claudin-1 (CLDN1), a tight junctional protein, is highly expressed in lung cancer cells and may contribute to chemoresistance. A drug which decreases CLDN1 expression could be a chemosensitizer for enhancing the efficacy of anticancer drugs, but there is no such
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.