Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU017091

Sigma-Aldrich

MISSION® esiRNA

targeting human RRM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCCAATAAAGATCGCCTGAATTCTGCTATTATCTATGACCGAGATTTCTCTTACAATTACTTCGGCTTTAAGACGCTAGAGCGGTCTTATTTGTTGAAGATCAATGGAAAAGTGGCTGAAAGACCACAACATATGTTGATGAGAGTATCTGTTGGGATCCACAAAGAAGACATTGATGCAGCAATTGAAACATATAATCTTCTTTCTGAGAGGTGGTTTACTCATGCTTCGCCCACTCTCTTCAATGCTGGTACCAACCGCCCACAACTTTCTAGCTGTTTTCTTCTGAGTATGAAAGATGACAGCATTGAAGGCATTTATGACACTCTAAAGCAATGTGCATTGATTTCTAAGTCTGCTGGAGGAATTGGTGTTGCTGTGAGTTGTATTCGGGCTACTGGCAGCTACATTGCTGGGACTAATGGC

N° accesso Ensembl | uomo

ENSG00000167325

N° accesso NCBI

NM_001033

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... RRM1(6240) , RRM1(6240)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
BWU
VIU
GRR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zarah Glad Zimling et al.
Anticancer research, 35(12), 6731-6738 (2015-12-08)
A possible predictive impact of ribonucleotide-reductase subunit-1 (RRM1) on vinorelbine efficacy in non-small cell lung cancer (NSCLC) has been previously reported. The present study aimed to further explore this finding in malignant pleural mesothelioma (MPM). Seventy-one patients with MPM receiving
Ribonucleotide Reductase Catalytic Subunit M1 (RRM1) as a Novel Therapeutic Target in Multiple Myeloma.
Morihiko Sagawa et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(17), 5225-5237 (2017-04-27)
Zhen Shu et al.
Oncogene, 39(35), 5721-5733 (2020-07-28)
Ribonucleotide reductase (RNR) catalyzes the rate-limiting step of de novo synthesis of deoxyribonucleotide triphosphates (dNTPs) building blocks for DNA synthesis, and is a well-recognized target for cancer therapy. RNR is a heterotetramer consisting of two large RRM1 subunits and two
Jianmei Wu et al.
Journal of chromatography. B, Analytical technologies in the biomedical and life sciences, 1006, 167-178 (2015-11-10)
Simultaneous, quantitative determination of intracellular nucleoside triphosphates and other polar metabolites using liquid chromatography with electrospray ionization tandem mass spectrometry (LC-MS/MS) represents a bioanalytic challenge because of charged, highly hydrophilic analytes presented at a large concentration range in a complex
Rong Yao et al.
PloS one, 10(5), e0125169-e0125169 (2015-05-07)
Pulmonary fibrosis is one of the most common complications of paraquat (PQ) poisoning, which demands for more effective therapies. Accumulating evidence suggests adiponectin (APN) may be a promising therapy against fibrotic diseases. In the current study, we determine whether the
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.