Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU016411

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPKAPK5 (2)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCTGGGAGCTGGAATTAGTGGTCCAGTTAGAGTCTGTGTAAAGAAATCTACTCAAGAACGGTTTGCGCTGAAAATTCTTCTTGATCGTCCAAAAGCTAGAAATGAGGTACGTCTGCACATGATGTGTGCCACACACCCAAACATAGTTCAGATTATTGAAGTGTTTGCTAACAGTGTCCAGTTTCCCCATGAGTCCAGCCCTAGGGCCCGACTCTTAATTGTAATGGAGATGATGGAAGGGGGAGAGCTATTTCACAGAATCAGCCAGCACCGGCACTTTACAGAGAAGCAAGCCAGCCAAGTAACAAAGCAGGCAACTTTGGCTCTGCGGCACTGTCACTTGTTAAACATTGCGCACAGAGACCTCAAGCCTGAAAATCTGCTTTTTAAGGATAACTCTTTGGATGCCCCAGTGAAGTTGTGTGACTTTGGATTTGCCAAGATTGACCAAGGTGACTTGATGACACCCCAGTTCACCCCTTATTATGTAGCACCCCAGGTACTGGA

N° accesso Ensembl | uomo

ENSG00000089022

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MAPKAPK5(8550) , MAPKAPK5(8550)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Sherin Ali Nawaito et al.
American journal of physiology. Heart and circulatory physiology, 316(6), H1281-H1296 (2019-03-23)
MK5 is a protein serine/threonine kinase activated by p38, ERK3, and ERK4 MAPKs. MK5 mRNA and immunoreactivity are detected in mouse cardiac fibroblasts, and MK5 haplodeficiency attenuates the increase in collagen 1-α1 mRNA evoked by pressure overload. The present study
Yoonhee Kim et al.
Molecular neurodegeneration, 11, 4-4 (2016-01-14)
The receptor for advanced glycation end products (RAGE) has been found to interact with amyloid β (Aβ). Although RAGE does not have any kinase motifs in its cytosolic domain, the interaction between RAGE and Aβ triggers multiple cellular signaling involved
Natalia Ronkina et al.
PloS one, 10(8), e0136138-e0136138 (2015-08-22)
MK5 (MAPK-activated protein kinase 5) or PRAK (p38-regulated and -activated kinase) are alternative names for a serine/threonine protein kinase downstream to ERK3/4 and p38 MAPK. A previous gene targeting approach for MK5/PRAK (termed here MK5/PRAK-Δex8) revealed a seemingly tumor-suppressive role
Katarzyna Bogucka et al.
eLife, 9 (2020-04-22)
ERK3 is a ubiquitously expressed member of the atypical mitogen activated protein kinases (MAPKs) and the physiological significance of its short half-life remains unclear. By employing gastrointestinal 3D organoids, we detect that ERK3 protein levels steadily decrease during epithelial differentiation.

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.