Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU014011

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCAGTGCTGGAGATCATTGCCTTTCATTGCAAGAGCCCGCACCGACACCGAATGGTCGTTTTGGAGCCCCTGAACAAACTGCTGCAGGCGAAATGGGATCTGCTCATCCCCAAGTTCTTCTTAAACTTCCTGTGTAATCTGATCTACATGTTCATCTTCACCGCTGTTGCCTACCATCAGCCTACCCTGAAGAAGGGCGCCGCCCCTCACCTGAAAGCGGAGGTTGGAAACTCCATGCTGCTGACGGGCCACATCCTTATCCTGCTAGGGGGGATCTACCTCCTCGTGGGCCAGCTGTGGTACTTCTGGCGGCGCCACGTGTTCATCTGGATCTCGTTCATAGACAGCTACTTTGAAATCCTCTTCCTGTTCCAGGCCCTGCTCACAGTGGTGTCCCAGGTGCTGTGTTTCCTGGCCATCGAGTGGTACCTGCCCCTGCTTGTGTCTGCGCTGGTGCTGGGCTGGCTGAACCTGCTTTACTATACACGTGGCTTCCAGCACACAGGCATCTAC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Agathe Oulidi et al.
PloS one, 8(5), e64885-e64885 (2013-06-07)
Adrenomedullin (AM) is a 52-amino acid peptide initially isolated from human pheochromocytoma. AM is expressed in a variety of malignant tissues and cancer cell lines and was shown to be a mitogenic factor capable of stimulating growth of several cancer
Michal Entin-Meer et al.
PloS one, 9(8), e105055-e105055 (2014-08-20)
A novel family of transient receptor potential (TRP) channels, that may hold a role in calcium homeostasis, has recently been described. By employing a GeneChip array analysis we have demonstrated a clear and specific upregulation of the TRP vanilloid 2
Taro Ishii et al.
Journal of dermatological science, 90(3), 332-342 (2018-04-04)
Keratinocytes release several factors that are involved in wound contracture and scar formation. We previously reported that a three-dimensional reconstruction model derived from rat skin represents a good wound healing model. We characterized the role of transient receptor potential (TRP)
Matthew R Cohen et al.
PloS one, 8(12), e85392-e85392 (2014-01-07)
Transient receptor potential vanilloid 2 (TRPV2) is a Ca(2+)-permeable nonselective cation channel proposed to play a critical role in a wide array of cellular processes. Although TRPV2 surface expression was originally determined to be sensitive to growth factor signaling, regulated
Toshiaki Sawatani et al.
American journal of physiology. Cell physiology, 316(3), C434-C443 (2019-01-17)
β-Cell swelling induces membrane depolarization, which has been suggested to be caused at least partly by the activation of cation channels. Here, we show the identification of the cation channels. In isolated mouse pancreatic β-cells, the exposure to 30% hypotonic

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.