Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU013881

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIB3

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGACTGCCCCCCTGCCTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCCTCCCGTCTTGGGCCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGCCCTACAGGCACTGAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTATGCGCGGCTGCCCCCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTACGCCTTTTTCACTCGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCTGAGGCTGCCGTGCTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTGCGTGATCTCAAGCTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Anna López-Plana et al.
International journal of cancer, 147(4), 1163-1179 (2020-01-17)
Around 40% of newly diagnosed lung cancer patients are Stage IV, where the improvement of survival and reduction of disease-related adverse events is the main goal for oncologists. In this scenario, we present preclinical evidence supporting the use of ABTL0812
Shuyi Wang et al.
Biochimica et biophysica acta, 1863(12), 3060-3074 (2017-09-25)
Endoplasmic reticulum (ER) stress has been demonstrated to prompt various cardiovascular risks although the underlying mechanism remains elusive. Protein tyrosine phosphatase-1B (PTP1B) serves as an essential negative regulator for insulin signaling. This study examined the role of PTP1B in ER
Seong-Hoon Yun et al.
Oncotarget, 9(1), 495-511 (2018-02-09)
We previously demonstrated that the quinovose-containing hexaoside stichoposide C (STC) is a more potent anti-leukemic agent than the glucose-containing stichoposide D (STD), and that these substances have different molecular mechanisms of action. In the present study, we investigated the novel
Xin Hu et al.
International journal of molecular sciences, 21(4) (2020-02-20)
NCAPG is a subunit of condensin I that plays a crucial role in chromatin condensation during mitosis. NCAPG has been demonstrated to be associated with farm animal growth traits. However, its role in regulating myoblast differentiation is still unclear. We
Yiteng Meng et al.
Digestive diseases and sciences, 64(8), 2167-2176 (2019-02-15)
The Tec kinase family is involved in acute and chronic inflammatory diseases, but its relationship with severe acute pancreatitis (SAP) remains unclear. To investigate whether Tec tyrosine kinase can be used as a target for severe acute pancreatitis-associated acute lung

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.