Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU011481

Sigma-Aldrich

MISSION® esiRNA

targeting human PROM1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTCGGAAACTGGCAGATAGCAATTTCAAGGACTTGCGAACTCTCTTGAATGAAACTCCAGAGCAAATCAAATATATATTGGCCCAGTACAACACTACCAAGGACAAGGCGTTCACAGATCTGAACAGTATCAATTCAGTGCTAGGAGGCGGAATTCTTGACCGACTGAGACCCAACATCATCCCTGTTCTTGATGAGATTAAGTCCATGGCAACAGCGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCTGAATAGCAACCCTGAACTGAGGCAGCTTCCACCCGTGGATGCAGAACTTGACAACGTTAATAACGTTCTTAGGACAGATTTGGATGGCCTGGTCCAACAGGGCTATCAATCC

N° accesso Ensembl | uomo

ENSG00000007062

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... PROM1(8842) , PROM1(8842)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
HLU
IKU
QCS
TFU
WAU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jong Woo Park et al.
Molecules (Basel, Switzerland), 25(14) (2020-07-12)
The pharmacological effects of BST204-a fermented ginseng extract-on several types of cancers have been reported. However, the effects of ginseng products or single ginsenosides against cancer stem cells are still poorly understood. In this study, we identified the anti-tumorigenic and
Liang-Yu Lin et al.
Cardiovascular diabetology, 13, 111-111 (2014-07-17)
Circulating endothelial progenitor cells (EPCs) reflect endothelial repair capacity and may be a significant marker for the clinical outcomes of cardiovascular disease. While some high-dose statin treatments may improve endothelial function, it is not known whether different statins may have
Yanli Jin et al.
BMC cancer, 15, 226-226 (2015-04-18)
Acute lymphoblastic leukemia (ALL) is a heterogeneous group of malignant disorders derived from B- or T-cell lymphoid progenitor cells. ALL often is refractory to or relapses after treatment; thus, novel targeted therapy for ALL is urgently needed. In the present
Hideki Izumi et al.
Scientific reports, 9(1), 2236-2236 (2019-02-21)
CD133 is a transmembranous protein that mainly localises to the plasma membrane in haematopoietic and neural stem cells as well as cancer stem cells. Although CD133 also localises to the cytoplasm, the mechanism of action and function of cytoplasmic CD133
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.