Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU011461

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP4

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCC

N° accesso Ensembl | uomo

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xiaoqing Zhang et al.
Cell death discovery, 7(1), 51-51 (2021-03-17)
Alzheimer's disease (AD) is a chronic progressive degenerative disease of the nervous system. Its pathogenesis is complex and is related to the abnormal expression of the amyloid β (Aβ), APP, and Tau proteins. Evidence has demonstrated that bone morphogenetic protein
Thomas Helbing et al.
Inflammation, 40(6), 1862-1874 (2017-07-30)
Leukocyte recruitment is a fundamental event in the response of the innate immune system to injury. This process is promoted in part by the opening of endothelial cell adherens junctions that allows leukocyte extravasation through gaps between adjacent endothelial cells.
Janice Siu Chong Wong et al.
Experimental eye research, 181, 185-189 (2019-02-06)
Periorbital adipose tissue expansion is a key pathological change in thyroid associated orbitopathy (TAO). Bone morphogenic protein 4 (BMP4) is instrumental in adipogenesis. We compared site-specific BMP4 expression and its effect on adipogenesis using donor-matched adipose tissue-derived stromal cells (ADSC)
Huiming Ju et al.
Molecular medicine reports, 13(3), 2194-2200 (2016-01-20)
MicroRNA-378 (miRNA-378) has been reported to have a crucial role in skeletal muscle differentiation; however, the underlying mechanisms have largely remained to be elucidated. The present study employed high‑throughput RNA sequencing to investigate the transcriptome following transfection of miRNA‑378 mimics
Thomas Helbing et al.
Inflammation, 40(2), 442-453 (2016-12-21)
The endothelium serves as a selective barrier and controls the exchange of nutrients, hormones, and leukocytes between blood and tissues. Molecular mechanisms contributing to the pathogenesis of endothelial barrier dysfunction remain incompletely understood. Accumulating evidence implicates bone morphogenetic protein (BMP)-modulator

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.