Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU010941

Sigma-Aldrich

MISSION® esiRNA

targeting human CYBB

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Spedizione prevista il16 aprile 2025

Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Spedizione prevista il16 aprile 2025

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GCTTGTGGCTGTGATAAGCAGGAGTTTCAAGATGCGTGGAAACTACCTAAGATAGCGGTTGATGGGCCCTTTGGCACTGCCAGTGAAGATGTGTTCAGCTATGAGGTGGTGATGTTAGTGGGAGCAGGGATTGGGGTCACACCCTTCGCATCCATTCTCAAGTCAGTCTGGTACAAATATTGCAATAACGCCACCAATCTGAAGCTCAAAAAGATCTACTTCTACTGGCTGTGCCGGGACACACATGCCTTTGAGTGGTTTGCAGATCTGCTGCAACTGCTGGAGAGCCAGATGCAGGAAAGGAACAATGCCGGCTTCCTCAGCTACAACATCTACCTCACTGGCTGGGATGAGTCTCAGGCCAATCACTTTGCTGTGCACCATGATGAGGAGAAAGATGTGATCACAGGCCTGAAACAAAAGACTTTGTATGGACGGCCCAACTGGGATAATGAATTCAAGACAATTGCAAGTCAACACCCTAATACCAGAATAGGAGTTTTCCTCTGTGGACCTGAAGC

N° accesso Ensembl | uomo

ENSG00000165168

N° accesso NCBI

NM_000397

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... CYBB(1536) , CYBB(1536)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
TDV
ACVC
KCU
QCS
CWR

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xianzhang Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 50(2), 783-797 (2018-10-15)
Peri-operative cerebral ischemia reperfusion injury is one of the most serious peri-operative complications that can be aggravated in patients with diabetes. A previous study showed that microglia NOX2 (a NADPH oxidase enzyme) may play an important role in this process.
Young-Mee Kim et al.
American journal of physiology. Cell physiology, 312(6), C749-C764 (2017-04-21)
Reactive oxygen species (ROS) derived from NADPH oxidase (NOX) and mitochondria play a critical role in growth factor-induced switch from a quiescent to an angiogenic phenotype in endothelial cells (ECs). However, how highly diffusible ROS produced from different sources can
Wenjun Wang et al.
Brain research bulletin, 160, 141-149 (2020-05-12)
Sleep deprivation (SD) can induce cognitive and memory impairments. This impairment is in part due to oxidative stress damage in the hippocampus region of the brain. Corilagin (CL), a polyphenol belonging to the tannin family and extracted from Terminalia chebula
Yongpan Huang et al.
Oxidative medicine and cellular longevity, 2020, 3912173-3912173 (2020-12-05)
Oxymatrine (OMT) is the major quinolizidine alkaloid extracted from the root of Sophora flavescens Ait and has been shown to exhibit a diverse range of pharmacological properties. The aim of the present study was to investigate the role of OMT
Christopher R Marlein et al.
Blood, 130(14), 1649-1660 (2017-07-25)
Improvements in the understanding of the metabolic cross-talk between cancer and its microenvironment are expected to lead to novel therapeutic approaches. Acute myeloid leukemia (AML) cells have increased mitochondria compared with nonmalignant CD34
Visualizza tutti i documenti correlati

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.