Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU006001

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCF

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

ACCCAAATCTCCAGGAGGACTCTCTGATGAAGACCCAGGCGGAGCTGCTGCTGGAGCGTCTGCAGGAGGTGGGGAAGGCCGAAGCGGAGCGTCCCGCCAGGTTTCTCAGCAGCCTGTGGGAGCGCTTGCCTCAGAACAACTTCCTGAAGGTGATAGCGGTGGCGCTGTTGCAGCCGCCTTTGTCTCGTCGGCCCCAAGAAGAGTTGGAACCCGGCATCCACAAATCACCTGGAGAGGGGAGCCAAGTGCTAGTCCACTGGCTTCTGGGGAATTCGGAAGTCTTTGCTGCCTTTTGTCGCGCCCTCCCAGCCGGGCTTTTGACTTTAGTGACTAGCCGCCACCCAGCGCTGTCTCCTGTCTATCTGGGTCTGCTAACAGACTGGGGTCAACGTTTGCACTATGACCTTCAGAAAGGCATTTGGGTTGGAACTGAGTCC

N° accesso Ensembl | uomo

ENSG00000183161

N° accesso NCBI

NM_022725

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... FANCF(2188) , FANCF(2188)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Miao He et al.
Oncology reports, 29(5), 1721-1729 (2013-02-27)
In the present study, we downregulated FANCF expression by small interfering RNA (siRNA) in OVCAR ovarian cancer cells to address the effects of decreased FANCF expression on the function of the Fanconi anemia (FA)/breast cancer susceptibility gene (BRCA) pathway. Furthermore
Yanlin Li et al.
PloS one, 7(8), e44254-e44254 (2012-09-07)
Fanconi anemia complementation group-F (FANCF) is a key factor to maintain the function of FA/BRCA, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In this study, we examined the effects and
Jiankun Yu et al.
International journal of nanomedicine, 11, 6651-6666 (2016-12-21)
Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N'-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short
Jiankun Yu et al.
Journal of breast cancer, 16(3), 291-299 (2013-10-25)
Fanconi anemia complementation group F (FANCF) is a key factor to maintaining the function of Fanconi anaemia/BRCA (FA/BRCA) pathway, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In the present study
Lin Zhao et al.
International journal of oncology, 45(1), 129-138 (2014-05-03)
The Fanconi anemia/BRCA (FA/BRCA) DNA damage repair pathway plays a pivotal role in the cellular response to DNA alkylating agents and greatly influences drug response in cancer treatment. However, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.