Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU005981

Sigma-Aldrich

MISSION® esiRNA

targeting human EPS8

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGAATGGCTACGGATCATCACCTACCTTTTCCCAGACGGACAGAGAACATGGTTCAAAAACAAGTGCAAAGGCCCTTTATGAACAAAGGAAGAATTATGCACGGGACAGTGTCAGCAGTGTGTCAGATATATCTCAATACCGTGTTGAACACTTGACTACCTTTGTCCTGGATCGGAAAGATGCTATGATCACTGTTGATGATGGAATAAGGAAATTGAAATTGCTTGATGCCAAGGGCAAAGTGTGGACTCAAGATATGATTCTTCAAGTGGATGACAGAGCTGTGAGCCTGATTGATTTAGAATCAAAGGCAAGTAATGAACTGGAGAATTTTCCTTTAAACACAATCCAGCACTGCCAAGCTGTGATGCATTCATGCAGCTATGATTCAGTTCTTGCACTGGTGTGCAAAGAGCCAACCCAGAACAAGCCAGAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jieyun Zhang et al.
Acta biochimica et biophysica Sinica, 52(3), 259-267 (2020-03-10)
Tumor metastasis is the main cause of treatment failure and death in patients with late stage of gastric cancer (GC). Studies showed that microRNAs (miRNAs) are important regulators in the process of tumor metastasis. In this study, we used miRNA
Huifang Lu et al.
Molecular medicine reports, 14(6), 4999-5006 (2016-11-15)
Epidermal growth factor receptor pathway substrate 8 (EPS8) is critical in the proliferation, progression and metastasis of solid and hematological types of cancer, and thus constitutes an ideal target for cancer immunotherapy. The present study aimed to identify human leukocyte antigen
Quan Yuan et al.
International journal of pharmaceutics, 557, 178-181 (2019-01-01)
We developed polyamidoamine dendrimers conjugated with epidermal growth factor (EGF) for use in receptor-mediated delivery of therapeutics to cancer cells. Here, we demonstrate the utility of this approach to inhibit proliferation and migration of head and neck squamous carcinoma cells
Haruhi Fukuhisa et al.
Journal of human genetics, 64(6), 521-534 (2019-03-13)
Our ongoing analyses identifying dysregulated microRNAs (miRNAs) and their controlled target RNAs have shed light on novel oncogenic pathways in pancreatic ductal adenocarcinoma (PDAC). The PDAC miRNA signature obtained by RNA sequencing showed that both strands of pre-miR-130b (miR-130b-5p, the
Elisa Cappellini et al.
Life sciences, 131, 30-36 (2015-04-22)
Eps8 is an actin-binding protein which has been proposed as a regulator of cancer cell motility and invasion. However, nothing much is known about its contribution to the invasive properties of endothelial cells (ECs), and more generally to angiogenesis. Expression

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.