Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU003961

Sigma-Aldrich

MISSION® esiRNA

targeting human USP13

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

AGATCGCCTGATGAACCAATTGATAGACCCATCAGACATCGATGAGTCATCAGTGATGCAGCTGGCCGAGATGGGTTTCCCGCTGGAAGCATGTCGCAAGGCTGTGTACTTCACTGGAAATATGGGCGCCGAGGTGGCCTTCAACTGGATCATTGTTCACATGGAAGAGCCAGATTTTGCTGAGCCGCTGACCATGCCTGGTTATGGAGGGGCAGCTTCTGCTGGAGCCTCTGTTTTTGGTGCTTCTGGACTGGATAACCAACCTCCAGAGGAAATCGTAGCTATCATCACCTCCATGGGATTTCAGCGAAATCAGGCTATTCAGGCACTACGAGCAACGAATAATAACCTGGAAAGAGCACTGGATTGGATCTTTAGCCACCCTGAGTTTGAAGAAGACAGTGATTTTGTGATTGAGATGGAGAATAATGCCAATGCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Yue Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 114, 108831-108831 (2019-04-16)
USP13 is emerging as a potential target in cancer therapy. However, the effect of USP13 on tumor progression is controversial. Here we focused on non-small cell lung cancer (NSCLC), a common cancer with high mortality, and studied the role of
Yuning Liao et al.
Journal of experimental & clinical cancer research : CR, 38(1), 157-157 (2019-04-13)
Prostate cancer (PCa) remains a challenge worldwide. Due to the development of castration-resistance, traditional first-line androgen deprivation therapy (ADT) became powerlessness. Epidermal growth factor receptor (EGFR) is a well characterized therapeutic target to treat colorectal carcinoma and non-small cell lung
Xiaoguang Fang et al.
The Journal of experimental medicine, 214(1), 245-267 (2016-12-08)
Glioblastoma is the most lethal brain tumor and harbors glioma stem cells (GSCs) with potent tumorigenic capacity. The function of GSCs in tumor propagation is maintained by several core transcriptional regulators including c-Myc. c-Myc protein is tightly regulated by posttranslational
Shan Gao et al.
Frontiers in cell and developmental biology, 8, 587389-587389 (2020-11-17)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer death worldwide. The activation of the toll-like receptor 4/myeloid differentiation primary response gene 88/nuclear factor-κB (TLR4/MyD88/NF-κB) pathway contributes to the development and progression of HCC. The ubiquitin-proteasome system regulates

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.