Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU002711

Sigma-Aldrich

MISSION® esiRNA

targeting human BIRC2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTGGCCTGATGCTGGATAACTGGAAACTAGGAGACAGTCCTATTCAAAAGCATAAACAGCTATATCCTAGCTGTAGCTTTATTCAGAATCTGGTTTCAGCTAGTCTGGGATCCACCTCTAAGAATACGTCTCCAATGAGAAACAGTTTTGCACATTCATTATCTCCCACCTTGGAACATAGTAGCTTGTTCAGTGGTTCTTACTCCAGCCTTTCTCCAAACCCTCTTAATTCTAGAGCAGTTGAAGACATCTCTTCATCGAGGACTAACCCCTACAGTTATGCAATGAGTACTGAAGAAGCCAGATTTCTTACCTACCATATGTGGCCATTAACTTTTTTGTCACCATCAGAATTGGCAAGAGCTGGTTTTTATTATATAGGACCTGGAGATAGGGTAGCCTGCTTTGCCTGTGGTGGGAAGCTCAGTAACTGGGAACCAAAGGATGATGCTATGTCAGAACACCGGAGGCATTTTCCCAACTGTCCATTTTTGGAAAATTCTCTAGAAACTCTGAGGTTTAGCATTTCAAATCTGAGCATGCAGACACATGCAGCTCGAAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xin Wang et al.
International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience, 53, 10-17 (2016-05-26)
Bone morphogenic protein-7 (BMP7) is a multifunctional cytokine with demonstrated neurogenic potential. Oligodendrocytes (OLs) death after spinal cord injury (SCI) contributes to demyelination of spared axons, even leading to a permanent neurological deficit. Therefore, therapeutic approaches to prevent OLs death
M Lappas
Placenta, 35(10), 831-838 (2014-08-13)
Independent of their role in apoptosis, cellular inhibitors of apoptosis (cIAP) 1 and 2, have emerged as regulators of inflammation. Obesity in pregnancy is characterised by maternal and placental inflammation. Thus, the aim of this study was to determine the
Franziska Mueller et al.
Science advances, 7(3) (2021-02-02)
SMAC/DIABLO and HTRA2 are mitochondrial proteins whose amino-terminal sequences, known as inhibitor of apoptosis binding motifs (IBMs), bind and activate ubiquitin ligases known as inhibitor of apoptosis proteins (IAPs), unleashing a cell's apoptotic potential. IBMs comprise a four-residue, loose consensus
Hong Jin et al.
Oncology research, 22(3), 167-176 (2015-07-15)
Emerging evidence suggests a potential role of cellular inhibitor of apoptosis protein 1 (cIAP1) in the development of human ovarian cancer. However, its function in the progression of ovarian cancer has not been clearly determined. Our study aimed to investigate
E-W Lee et al.
Cell death and differentiation, 22(9), 1463-1476 (2015-01-24)
Given their crucial role in apoptosis suppression, inhibitor of apoptosis proteins (IAPs) have recently become attractive targets for cancer therapy. Here, we report that cellular IAP2 (cIAP2) is specifically stabilized in several cancer cell lines, leading to resistance to Smac

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.