Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU002061

Sigma-Aldrich

MISSION® esiRNA

targeting human TAAR1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGCCTCCATTTTCCATTTGTCTTTCATCTCCATTGACCGCTACTATGCTGTGTGTGATCCACTGAGATATAAAGCCAAGATGAATATCTTGGTTATTTGTGTGATGATCTTCATTAGTTGGAGTGTCCCTGCTGTTTTTGCATTTGGAATGATCTTTCTGGAGCTAAACTTCAAAGGCGCTGAAGAGATATATTACAAACATGTTCACTGCAGAGGAGGTTGCTCTGTCTTCTTTAGCAAAATATCTGGGGTACTGACCTTTATGACTTCTTTTTATATACCTGGATCTATTATGTTATGTGTCTATTACAGAATATATCTTATCGCTAAAGAACAGGCAAGATTAATTAGTGATGCCAATCAGAAGCTCCAAATTGGATTGGAAATGAAAAATGGAATTTCACAAAGCAAAGAAAGGAAAGCTGTGAAGACATTGGGGAT

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

D Almeida-Santos et al.
Journal of molecular neuroscience : MN, 71(3), 625-637 (2020-08-21)
The choroid plexus (CP) constitutes a barrier between the blood and the cerebrospinal fluid (CSF) which regulates the exchange of substances between these two fluids through mechanisms that are not completely understood. Polyamines as spermine, spermidine and putrescine are produced
Mallory S Pitts et al.
Histochemistry and cell biology, 152(2), 155-166 (2019-05-22)
Trace amine-associated receptors are G protein-coupled receptors of which TAAR1 is the most well-studied. Recently, Vattai et al. (J Cancer Res Clin Oncol 143:1637-1647 https://doi.org/10.1007/s00432-017-2420-8 , 2017) reported that expression of TAAR1 may be a marker of breast cancer (BC)
Uma Sriram et al.
Journal of leukocyte biology, 99(1), 213-223 (2015-08-26)
The novel transmembrane G protein-coupled receptor, trace amine-associated receptor 1 (TAAR1), represents a potential, direct target for drugs of abuse and monoaminergic compounds, including amphetamines. For the first time, our studies have illustrated that there is an induction of TAAR1

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.