Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

Visualizza tutta la documentazione

EHU002001

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
CHF 249.00
50 μG
CHF 443.00

CHF 249.00

Check Cart for Availability
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
CHF 249.00
50 μG
CHF 443.00

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

CHF 249.00

Check Cart for Availability

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

100

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGA

N° accesso Ensembl | uomo

ENSG00000196591

N° accesso NCBI

NM_001527

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... HDAC2(3066) , HDAC2(3066)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
QCS
WUT
GJT
QCT
MZS

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jie Gao et al.
Gene, 678, 1-7 (2018-08-01)
Chronic diabetic foot ulcer (DFU) is a major cause of disability and mortality in patients with diabetes. Dysfunctional endothelial progenitor cells (EPCs) play important roles in preventing vascular complications in these patients. Our results determined the elevated expression of histone
Wen-Feng Fang et al.
Journal of inflammation (London, England), 15, 3-3 (2018-01-19)
Sepsis is a life-threatening organ dysfunction caused by dysregulated host response to infection, and is primarily characterized by an uncontrolled systemic inflammatory response. In the present study, we developed an effective adjunct therapy mediated by a novel mechanism, to attenuate
Ziran Wang et al.
Molecular therapy oncolytics, 17, 547-561 (2020-07-09)
Hepatocellular carcinoma (HCC) is a common malignant tumor. LukS-PV is the S component of Panton-Valetine leukocidin (PVL), which is secreted by Staphylococcus aureus. This study investigated the effects of LukS-PV on the proliferation, apoptosis, and cell-cycle progression of HCC cells
David B Wang et al.
Brain pathology (Zurich, Switzerland), 29(2), 164-175 (2018-07-22)
Histone deacetylases (HDACs) catalyze acetyl group removal from histone proteins, leading to altered chromatin structure and gene expression. HDAC2 is highly expressed in adult brain, and HDAC2 levels are elevated in Alzheimer's disease (AD) brain. We previously reported that neuron-specific
Shenglei Li et al.
Oncology letters, 13(1), 403-409 (2017-01-27)
Increasing evidence has demonstrated that histone deacetylase 2 (HDAC2) participates in the regulation of a variety of biological processes in numerous tumors. However, the potential role of HDAC2 in the development and progression of esophageal squamous cell carcinoma (ESCC) remains
Visualizza tutti i documenti correlati

Questions

Reviews

No rating value

Active Filters

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.