Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU000271

Sigma-Aldrich

MISSION® esiRNA

targeting human F2R

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGGGCTCAACATCACTACCTGTCATGATGTGCTCAATGAAACCCTGCTCGAAGGCTACTATGCCTACTACTTCTCAGCCTTCTCTGCTGTCTTCTTTTTTGTGCCGCTGATCATTTCCACGGTCTGTTATGTGTCTATCATTCGATGTCTTAGCTCTTCCGCAGTTGCCAACCGCAGCAAGAAGTCCCGGGCTTTGTTCCTGTCAGCTGCTGTTTTCTGCATCTTCATCATTTGCTTCGGACCCACAAACGTCCTCCTGATTGCGCATTACTCATTCCTTTCTCACACTTCCACCACAGAGGCTGCCTACTTTGCCTACCTCCTCTGTGTCTGTGTCAGCAGCATAAGCTGCTGCATCGACCCCCTAATTTACTATTACGCTTCCTCTGAGTGCCAGAGGTACGTCTACAGTATCTTATGCTGCAAAGAAAGTTCCGATCCCA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Zhuang-Zhuang Tang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 78, 153314-153314 (2020-09-04)
Sarsasapogenin (Sar) shows good effects on diabetic nephropathy (DN) through inhibition of the NLRP3 inflammasome, yet the potential mechanism is not well known. This study was designed to explore the regulation of thrombin and/or its receptor protease-activated receptor 1 (PAR-1)
Omozuanvbo Aisiku et al.
Blood, 125(12), 1976-1985 (2015-01-15)
Protease-activated receptor-1 (PAR1) couples the coagulation cascade to platelet activation during myocardial infarction and to endothelial inflammation during sepsis. This receptor demonstrates marked signaling bias. Its activation by thrombin stimulates prothrombotic and proinflammatory signaling, whereas its activation by activated protein
Clément d'Audigier et al.
Angiogenesis, 18(3), 347-359 (2015-06-01)
Endothelial colony forming cells (ECFC) represent a subpopulation of endothelial progenitor cells involved in endothelial repair. The activation of procoagulant mechanisms associated with the vascular wall's inflammatory responses to injury plays a crucial role in the induction and progression of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.