Accéder au contenu
Merck
Toutes les photos(1)

Documents

HLTUD0007

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor, Human

hsa-let-7b-5p

Synonyme(s) :

hsa-let-7b, Tough Decoy, TuD

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41106609
Nomenclature NACRES :
NA.51

Gamme de produits

MISSION®

Forme

liquid

Concentration

≥1x106 VP/ml (via p24 assay)

Technique(s)

capture ELISA: 106 TU/mL using p24 (Volume 200 uL)

Séquence mature

UGAGGUAGUAGGUUGUGUGGUU

Numéro d'accès Sanger mature/mineur

MIMAT0000063

Numéro d'accès Sanger microARN

MI0000063

Conditions d'expédition

dry ice

Température de stockage

−70°C

Description générale

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Autres remarques

Based on miRBase V19 Mature ID

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 3

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jaira F de Vasconcellos et al.
Journal of translational medicine, 15(1), 169-169 (2017-08-05)
In humans, the heterochronic cascade composed of the RNA-binding protein LIN28 and its major target, the let-7 family of microRNAs (miRNAs), is highly regulated during human erythroid ontogeny. Additionally, down-regulation of the let-7 miRNAs in cultured adult CD34(+) cells or

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique