Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU203261

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Socs1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCTGCTGTGCAGAATATCCTATTTTATATTTTTACAGCCAGTTTAGGTAATAAACTTTATTATGAAAGTTTTTTTTTAAAAGAAACAAAGATTCCTAGAGCGTATGCTTTGGCCAAACGTCCTGGGTTGGGAGTGGGGTATACAGACTGACTTTTCTTGAAGTCTTCGGGATGCTGGGGGGAGGGGGGAGGGTCGGACATCATATACATCTCCACCCACAGTGATGGGGACCAAACTTCCAGGCTAGTTGTGGTTTATGACTGGGAAGATGGCCGCTCCTGAGTATCCGTGCCTGGTCTCTGGTATTTCTGTGATGGGATCCTACAGGGACAGCCCCTGACACTGAGTACTGTGTTGCCCCCAGTATACAGAGGAGAAAACTGAGAGACGGGTAATTGACGACAGACCATTCCTGGACTGGAGAGGTGGGCCTTTTAACTGTCCATCCTGCATCAATTTGAAATGGATGACAGAGAGGAAACTTCTTTGCTTCTCTGACCACAACTACTTCCAGGA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hua-Bing Li et al.
Nature, 548(7667), 338-342 (2017-08-10)
N
Wai Po Chong et al.
Immunity, 53(2), 384-397 (2020-07-17)
Dysregulated Th17 cell responses underlie multiple inflammatory and autoimmune diseases, including autoimmune uveitis and its animal model, EAU. However, clinical trials targeting IL-17A in uveitis were not successful. Here, we report that Th17 cells were regulated by their own signature
Gang Xu et al.
Virology, 462-463, 343-350 (2014-07-16)
MiR-221 was reported to be upregulated and play roles in tumorigenesis of hepatitis C virus (HCV) associated hepatocellular carcinoma (HCC). However, the role of miR-221 in HCV infection remains unknown. In this study, it was found that miR-221 was upregulated
Chulwon Kim et al.
Oncotarget, 6(6), 4020-4035 (2015-03-05)
Artesunate (ART), a semi-synthetic derivative of artemisinin, is one of the most commonly used anti-malarial drugs. Also, ART possesses anticancer potential albeit through incompletely understood molecular mechanism(s). Here, the effect of ART on various protein kinases, associated gene products, cellular

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique