Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU063061

Sigma-Aldrich

MISSION® esiRNA

targeting mouse C3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACGCCACTATGTCCATCCTGGACATCTCCATGATGACTGGCTTTGCTCCAGACACAAAGGACCTGGAACTGCTGGCCTCTGGAGTAGATAGATACATCTCCAAGTACGAGATGAACAAAGCCTTCTCCAACAAGAACACCCTCATCATCTACCTAGAAAAGATTTCACACACCGAAGAAGACTGCCTGACCTTCAAAGTTCACCAGTACTTTAATGTGGGACTTATCCAGCCCGGGTCGGTCAAGGTCTACTCCTATTACAACCTCGAGGAATCATGCACCCGGTTCTATCATCCAGAGAAGGACGATGGGATGCTCAGCAAGCTGTGCCACAGTGAAATGTGCCGGTGTGCTGAAGAGAACTGCTTCATGCAACAGTCACAGGAGAAGATCAACCTGAATGTCCGG

Numéro d'accès Ensembl | souris

ENSMUSG00000024164

Numéro d'accès NCBI

NM_009778

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... C3(12266) , C3(12266)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Manuela Veglia et al.
American journal of reproductive immunology (New York, N.Y. : 1989), 74(6), 542-552 (2015-09-22)
A threefold higher prevalence of antinuclear antibodies (ANA) has been reported in patients with recurrent pregnancy loss (RPL). Nevertheless, the role of ANA in reproductive failure is still unclear. The aim of this study was to investigate the role of
Eva-Maria Nichols et al.
Kidney international, 88(6), 1314-1322 (2015-07-30)
Abnormal regulation of the complement alternative pathway is associated with C3 glomerulopathy. Complement factor H is the main plasma regulator of the alternative pathway and consists of 20 short consensus repeat (SCR) domains. Although recombinant full-length factor H represents a
Masanori A Murayama et al.
Nature communications, 6, 8483-8483 (2015-09-26)
The complement system is important for the host defence against infection as well as for the development of inflammatory diseases. Here we show that C1q/TNF-related protein 6 (CTRP6; gene symbol C1qtnf6) expression is elevated in mouse rheumatoid arthritis (RA) models.
Hiroyuki Inoshita et al.
PloS one, 8(11), e78736-e78736 (2013-11-14)
The link between glomerular IgA nephropathy (IgAN) and T helper 2 (Th2) response has been implicated, however, the mechanisms are poorly defined because of the lack of an appropriate model. Here we report a novel murine model characterized by lineage-restricted
Miriam D Neher et al.
Journal of neuroinflammation, 11, 95-95 (2014-06-03)
Complement activation at the C3 convertase level has been associated with acute neuroinflammation and secondary brain injury after severe head trauma. The present study was designed to test the hypothesis that Cr2-/- mice, which lack the receptors CR2/CD21 and CR1/CD35
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique