Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU062291

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tmem131

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGGATATGCGTGTGAGGGATATGGTTTTAAAGTGGTTAACTGTCAAGAGTTTGCCCTGAGTGCCAACGCCTCCAGAGACATAGTCATATTGTTTACTCCAGATTTCACAGCCTCCAGAGTCATTCGGGAGCTGAAGTTTGTGACAAGCAGTGGCTCCGAGTTTGTGTTTGTGTTGAATGCCTCTCTTCCGTACCACATGCTAGCCGCCTGTGCAGAAGCCCTCCCTAGACCCAACTGGGAGCTCGCGCTCTACATCATCATCTCCGGGGTCATGAGTGCACTCTTTCTCCTGGTCATTGGAACAGCCTACTTGGAAGCTCAAGGGATTTGGGAGCCCTTCCGAAGGCGACTCTCCTTTGAAGCCTCAAACCCGCCCTTTGATGTTGGAAGGCCATTTGATCTC

Numéro d'accès Ensembl | souris

ENSMUSG00000026116

Numéro d'accès NCBI

NM_018872

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... TMEM131(56030) , Tmem131(56030)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that
Yvonne Diener et al.
Scientific reports, 5, 17184-17184 (2015-11-26)
Modulation of gene expression is a useful tool to study the biology of haematopoietic stem and progenitor cells (HSPCs) and might also be instrumental to expand these cells for therapeutic approaches. Most of the studies so far have employed stable
Nicholas E Hoffman et al.
Molecular biology of the cell, 25(6), 936-947 (2014-01-17)
Emerging findings suggest that two lineages of mitochondrial Ca(2+) uptake participate during active and resting states: 1) the major eukaryotic membrane potential-dependent mitochondrial Ca(2+) uniporter and 2) the evolutionarily conserved exchangers and solute carriers, which are also involved in ion

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique