Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU061651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccne1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GATGGAGGTGTGCGAAGTCTATAAGCTCCACAGAGAGACGTTCTACTTGGCACAGGACTTCTTTGATCGTTACATGGCATCACAACAGAATATCATAAAAACACTTTTACAGCTTATTGGGATTTCAGCCTTATTTATTGCTTCAAAACTTGAGGAAATCTACCCTCCAAAGTTGCACCAGTTTGCTTATGTTACAGATGGCGCTTGCTCCGGGGATGAAATTCTTACCATGGAATTGATGATGATGAAGGCCCTTAAGTGGCGTCTAAGCCCTCTGACCATTGTGTCCTGGCTGAATGTCTATGTCCAAGTGGCCTATGTCAACGACACGGGTGAGGTGCTGATGCCTCAGTACCCACAGCAGGTCTTCGTGCAGATCGCAGAGCTTCTAGACCTGTGCGTCC

Numéro d'accès Ensembl | souris

ENSMUSG00000002068

Numéro d'accès NCBI

NM_007633

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CCNE1(12447) , Ccne1(12447)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhiyuan Han et al.
Oncotarget, 6(15), 13149-13163 (2015-04-25)
Cyclin E1, encoded by the CCNE1 gene, promotes G1/S transition, chromosome instability, and oncogenesis. Here, we show that miR-497 and miR-34a target the 3'-UTR of CCNE1. miR-497 and miR-34a are downregulated in cancer cells and their ectopic expression inhibited cell
Xiaoyang Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(2), 419-431 (2015-09-01)
The accumulation of free cholesterol in atherosclerotic lesions has been well documented in both animals and humans. In studying the relevance of free cholesterol buildup in atherosclerosis, contradictory results have been generated, indicating that free cholesterol produces both pro- and
Ning-Ai Liu et al.
The Journal of clinical endocrinology and metabolism, 100(7), 2557-2564 (2015-05-06)
Cushing disease, due to pituitary corticotroph tumor ACTH hypersecretion, drives excess adrenal cortisol production with adverse morbidity and mortality. Loss of glucocorticoid negative feedback on the hypothalamic-pituitary-adrenal axis leads to autonomous transcription of the corticotroph precursor hormone proopiomelanocortin (POMC), consequent

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique