Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU056201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TATCATCGCCATCAAGGACATCCTGAAGCCTACTGTGCCCTATGGAGAATTCAGATCTGTCTATGTGGTACTGGACCTCATGGAGAGCGACCTACACCAGATCATTCACTCTTCACAGCCGCTCACCCTGGAACATGTGAGATACTTCCTGTACCAGCTGCTTCGGGGCCTCAAATACATGCACTCTGCTCAGGTCATCCACCGTGATCTTAAACCCTCTAACCTTCTGGTCAATGAGAACTGTGAGCTCAAGATCGGTGACTTTGGAATGGCCCGTGGCCTCTGTACTTCCCCTGCCGAGCACCAGTACTTCATGACTGAGTATGTGGCTACTCGCTGGTACCGTGCCCCGGAGCTCATGCTTTCCCTGCACGAGTATACGCAGGCAATCGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCTCGGCGCCAGCTCTTCCCAGGCAAAAACTACGTGCACCAGTTACAGCTGATCATGATGGTGTTGG

Numéro d'accès Ensembl | souris

ENSMUSG00000001034

Numéro d'accès NCBI

NP_035971

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... MAPK7(23939) , Mapk7(23939)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yufeng Zuo et al.
Journal of cellular biochemistry, 116(1), 124-132 (2014-08-28)
Members of Rho family GTPases including Cdc42 are known to play pivotal roles in cell migration. Cell migration is also known to be regulated by many protein kinases. Kinetworks KPSS 11.0 phospho-site screening of Cdc42-silenced Hs578T breast cancer cells revealed
Paul R Gavine et al.
BMC cancer, 15, 454-454 (2015-06-05)
MAPK7/ERK5 (extracellular-signal-regulated kinase 5) functions within a canonical three-tiered MAPK (mitogen activated protein kinase) signaling cascade comprising MEK (MAPK/ERK kinase) 5, MEKK(MEK kinase) 2/3 and ERK5 itself. Despite being the least well studied of the MAPK-modules, evidence supports a role
Jin Jiang et al.
Molecular and cellular biochemistry, 406(1-2), 237-243 (2015-05-16)
Bone cells respond to various mechanical stimuli including fluid shear stress (FSS) in vitro. Induction of cyclooxygenase-2 (COX-2) is thought to be important for the anabolic effects of mechanical loading. Recently, extracellular-signal-regulated kinase 5 (ERK5) has been found to be
Uyen B Chu et al.
Biochimica et biophysica acta, 1850(7), 1415-1425 (2015-04-02)
Statins are potent inhibitors of cholesterol biosynthesis and are clinically beneficial in preventing cardiovascular diseases, however, the therapeutic utility of these drugs is limited by myotoxicity. Here, we explored the mechanism of statin-mediated activation of ERK5 in the human endothelium

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique