Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU030031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ddit3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAATAACAGCCGGAACCTGAGGAGAGAGTGTTCCAGAAGGAAGTGCATCTTCATACACCACCACACCTGAAAGCAGAACCTGGTCCACGTGCAGTCATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGATCTGCAGGAGGTCCTGTCCTCAGATGAAAATGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGAAGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACAGAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAGAGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCAACGCATGAAGGAGAAGGAGCAG

Numéro d'accès Ensembl | souris

ENSMUSG00000025408

Numéro d'accès NCBI

NM_007837

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... DDIT3(13198) , Ddit3(13198)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

E Aflaki et al.
Cell death & disease, 3, e280-e280 (2012-03-16)
Triacylglycerol (TG) accumulation caused by adipose triglyceride lipase (ATGL) deficiency or very low-density lipoprotein (VLDL) loading of wild-type (Wt) macrophages results in mitochondrial-mediated apoptosis. This phenotype is correlated to depletion of Ca(2+) from the endoplasmic reticulum (ER), an event known
Xin-Yu Zhang et al.
The international journal of biochemistry & cell biology, 68, 158-165 (2015-09-28)
Arsenic trioxide has been proven to trigger apoptosis in human hepatocellular carcinoma cells. Endoplasmic reticulum stress has been known to be involved in apoptosis through the induction of CCAAT/enhancer-binding protein homologous protein. However, it is unknown whether endoplasmic reticulum stress
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Lu Fan et al.
Toxicology and applied pharmacology, 278(1), 45-52 (2014-04-29)
Erlotinib, a popular drug for treating non-small cell lung cancer (NSCLC), causes diarrhea in approximately 55% of patients receiving this drug. In the present study, we found that erlotinib induced barrier dysfunction in rat small intestine epithelial cells (IEC-6) by
Bo Lin Chen et al.
Antioxidants & redox signaling, 23(15), 1233-1245 (2014-09-03)
Renal ischemia-reperfusion (I/R) is a major cause of acute renal failure. The mechanisms of I/R injury include endoplasmic reticulum (ER) stress, inflammatory responses, hypoxia, and generation of reactive oxygen species (ROS). CCAAT/enhancer-binding protein (C/EBP) homologous protein (CHOP) is involved in
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique