Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EMU022211

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Scyl1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGCCAGCTGAGAAGCAGAAGTTCTTCCAAGAGCTGAGCAAGAGTCTAGACTCATTTCCCGAAGATTTCTGTCGACACAAGGTGCTGCCCCAGCTACTGACTGCCTTTGAGTTTGGCAATGCTGGGGCCGTGGTCCTCACACCTCTCTTCAAGGTGGGAAAATCCCTCCGTGCTGAAGAGTACCAGGAGAAGATCATCCCTGTGGTAGTTAAGATGTTCTCATCCACCGACCGGGCCATGCGCATCCGCCTCCTCCAGCAGATGGAGCAGTTCATCCAATACCTTGATGAGCCAACAGTCAACACGCAGATTTTCCCCCACGTCACACATGGCTTCCTGGACACCAACCCCGCCATCCGCGAGCAGACGGTCAAGTCCATGCTGCTCTTGGCCCCAAAGCTGAATGAGGCCAATCTCAATGTGGAACTGATGAAGCACTTTGCAAGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Michael Hannus et al.
Nucleic acids research, 42(12), 8049-8061 (2014-05-31)
Short interfering RNAs (siRNAs) are widely used as tool for gene inactivation in basic research and therapeutic applications. One of the major shortcomings of siRNA experiments are sequence-specific off-target effects. Such effects are largely unpredictable because siRNAs can affect partially
Carsten Riether et al.
Cell reports, 34(4), 108663-108663 (2021-01-28)
Self-renewal is a key characteristic of leukemia stem cells (LSCs) responsible for the development and maintenance of leukemia. In this study, we identify CD93 as an important regulator of self-renewal and proliferation of murine and human LSCs, but not hematopoietic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique