Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU012411

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rab24

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGTGACCTGCTGGAGGAAGACAGGCGGCGCCGTCGTGTAGACTTCCATGATGTTCAGGACTATGCCGATAATATCAAAGCCCAACTCTTTGAAACATCCAGCAAGACAGGCCAAAGTGTGGATGAACTCTTCCAGAAAGTGGCTGAGGATTACGTCAGTGTGGCTGCTTTCCAGGTGATGACAGAGGACAAAGGTGTGGATTTGAGCCAGAAGGCAAACCCTTACTTCTACAGCTGTTGTCATCACTGAGTCACCAGTCATCTGGCCCAGTGGAATTAGATGAATTCCCAGAGGGGCTGGACCTGACTCTTGTCTGGGCTGGAATGGTCAAGCGTCTGAGCTATTCCAGGTGCCTCTCACAGCAGAGGTGGCACCTGCCTGTGCTGGCCCATGGAACGGAGGCAGTATTGGGCTGACTGTGGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Celina Amaya et al.
Traffic (Copenhagen, Denmark), 17(11), 1181-1196 (2016-10-27)
Endocytosis is a multistep process engaged in extracellular molecules internalization. Several proteins including the Rab GTPases family coordinate the endocytic pathway. The small GTPase Rab7 is present in late endosome (LE) compartments being a marker of endosome maturation. The Rab
Päivi Ylä-Anttila et al.
Autophagy, 11(10), 1833-1848 (2015-09-02)
RAB24 belongs to a family of small GTPases and has been implicated to function in autophagy. Here we confirm the intracellular localization of RAB24 to autophagic vacuoles with immuno electron microscopy and cell fractionation, and show that prenylation and guanine

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique