Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU232231

Sigma-Aldrich

MISSION® esiRNA

targeting human IRGM

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGAAGCCATGAATGTTGAGAAAGCCTCAGCAGATGGGAACTTGCCAGAGGTGATCTCTAACATCAAGGAGACTCTGAAGATAGTGTCCAGGACACCAGTTAACATCACTATGGCAGGGGACTCTGGCAATGGGATGTCCACCTTCATCAGTGCCCTTCGAAACACAGGACATGAGGGTAAGGCCTCACCTCCTACTGAGCTGGTAAAAGCTACCCAAAGATGTGCCTCCTATTTCTCTTCCCACTTTTCAAATGTGGTGTTGTGGGACCTGCCTGGCACAGGGTCTGCCACCACAACCCTGGAGAACTACCTGATGGAAATGCAGTTCAACCGGTATGACTTCATCATGGTTGCATCTGCACAATTCAGCATGAATCATGTGATGCTTGCCAAAACCGCTGAGGACATGGGAAAGAAGTTCTACATTGTCTGGACCAAGCTAGACATGGACCTCAGCACAGGTGCCCTCCCAGAAGTGCAGCTACTGCAGATCAGAGAAAATGTCCTGGAAAA

Numéro d'accès Ensembl | humain

ENSG00000237693

Numéro d'accès NCBI

NM_001145805

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IRGM(345611) , IRGM(345611)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yu-Cheng Lin et al.
Journal of hepatology, 65(6), 1209-1216 (2016-07-16)
Autophagy has been shown to be crucial in the regulation of the intracellular lipid stores in hepatocytes. We hypothesize that immunity-related GTPase family M (IRGM) gene (an autophagy-related gene) variants confer the susceptibility to non-alcoholic fatty liver disease (NAFLD) development.
Chih-Peng Chang et al.
PloS one, 6(12), e28323-e28323 (2011-12-14)
Interferon-gamma (IFN-γ), a potent Th1 cytokine with multiple biological functions, can induce autophagy to enhance the clearance of the invading microorganism or cause cell death. We have reported that Concanavalin A (Con A) can cause autophagic cell death in hepatocytes
Kautilya Kumar Jena et al.
EMBO reports, 21(9), e50051-e50051 (2020-07-28)
Activation of the type 1 interferon response is extensively connected to the pathogenesis of autoimmune diseases. Loss of function of Immunity Related GTPase M (IRGM) has also been associated to several autoimmune diseases, but its mechanism of action is unknown.
Xize Guo et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(11), 14768-14779 (2020-09-18)
Mitochondria is a double membrane-bound cellular organelle that generates energy to maintain the homeostasis of cells. Immunity-related GTPase M (IRGM) in human locates at the inner membrane of mitochondria and is best known for its role in regulating autophagy against

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique