Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU157781

Sigma-Aldrich

MISSION® esiRNA

targeting human FLNA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACATCATCCGCAATGACAATGACACCTTCACGGTCAAGTACACGCCCCGGGGGGCTGGCAGCTACACCATTATGGTCCTCTTTGCTGACCAGGCCACGCCCACCAGCCCCATCCGAGTCAAGGTGGAGCCCTCTCATGACGCCAGTAAGGTGAAGGCCGAGGGCCCTGGCCTCAGTCGCACTGGTGTCGAGCTTGGCAAGCCCACCCACTTCACAGTAAATGCCAAAGCTGCTGGCAAAGGCAAGCTGGACGTCCAGTTCTCAGGACTCACCAAGGGGGATGCAGTGCGAGATGTGGACATCATCGACCACCATGACAACACCTACACAGTCAAGTACACGCCTGTCCAGCAGGGTCCAGTAGGCGTCAATGTCACTTATGGAGGGGATCCCATCCCTAAGAGCCCTTTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qian Wang et al.
PloS one, 10(4), e0123018-e0123018 (2015-04-11)
Polycystin-2 (PC2), encoded by the PKD2 gene, is mutated in ~15% of autosomal dominant polycystic kidney disease. Filamins are actin-binding proteins implicated in scaffolding and membrane stabilization. Here we studied the effects of filamin on PC2 stability using filamin-deficient human
Anshika Sharma et al.
Frontiers in microbiology, 11, 581867-581867 (2020-10-27)
Influenza A virus (IAV) poses a major threat to global public health and is known to employ various strategies to usurp the host machinery for survival. Due to its fast-evolving nature, IAVs tend to escape the effect of available drugs
Alessandra Mingione et al.
Journal of molecular endocrinology, 58(2), 91-103 (2016-11-23)
Parathyroid tumors display reduced sensitivity to extracellular calcium ([Ca
E Peverelli et al.
Endocrinology, 155(8), 2932-2941 (2014-05-16)
Somatostatin receptor type 2 (SST2) is the main pharmacological target of medical therapy for GH-secreting pituitary tumors, but molecular mechanisms regulating its expression and signaling are largely unknown. The aim of this study was to investigate the role of cytoskeleton
Donatella Treppiedi et al.
Molecular and cellular endocrinology, 524, 111159-111159 (2021-01-12)
Somatostatin receptor type 5 (SST5) represents the main pharmacological target in the treatment of adrenocorticotroph hormone (ACTH)-secreting tumors. However, molecular predictors of responsiveness to pasireotide require further investigation. The cytoskeleton protein filamin A (FLNA) modulates the responsiveness to somatostatin analogs

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique