Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU151861

Sigma-Aldrich

MISSION® esiRNA

targeting human VIM

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTGAACGCAAAGTGGAATCTTTGCAAGAAGAGATTGCCTTTTTGAAGAAACTCCACGAAGAGGAAATCCAGGAGCTGCAGGCTCAGATTCAGGAACAGCATGTCCAAATCGATGTGGATGTTTCCAAGCCTGACCTCACGGCTGCCCTGCGTGACGTACGTCAGCAATATGAAAGTGTGGCTGCCAAGAACCTGCAGGAGGCAGAAGAATGGTACAAATCCAAGTTTGCTGACCTCTCTGAGGCTGCCAACCGGAACAATGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGC

Numéro d'accès Ensembl | humain

ENSG00000026025

Numéro d'accès NCBI

NM_003380

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... VIM(7431) , VIM(7431)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Brian Koons et al.
ACS nano, 11(12), 12037-12048 (2017-11-17)
Cell migration is studied with the traditional focus on protrusion-driven cell body displacement, while less is known on morphodynamics of individual protrusions themselves, especially in fibrous environments mimicking extracellular matrix. Here, using suspended fibers, we report integrative and multiscale abilities
Wei Wu et al.
Virology, 497, 41-52 (2016-07-17)
Influenza A virus exploits the subcellular transport machinery during the early stages of infection. Actin filaments and microtubules facilitate the trafficking of virus-containing endosomes towards the perinuclear region; however, the role of vimentin remains to be determined. In this study
Alison E Patteson et al.
Small (Weinheim an der Bergstrasse, Germany), 15(50), e1903180-e1903180 (2019-11-14)
The migration of cells through constricting spaces or along fibrous tracks in tissues is important for many biological processes and depends on the mechanical properties of a cytoskeleton made up of three different filaments: F-actin, microtubules, and intermediate filaments. The
Souneek Chakraborty et al.
Cell death & disease, 10(6), 467-467 (2019-06-15)
Epithelial to mesenchymal transitions (EMT) is a preparatory process for cancer cells to attain motility and further metastasis to distant sites. Majority of DNA damaging drugs have shown to develop EMT as one of the major mechanisms to attain drug
Masaki Makise et al.
BMC cancer, 18(1), 519-519 (2018-05-05)
Nucleoporin Nup88, a component of nuclear pore complexes, is known to be overexpressed in several types of tumor tissue. The overexpression of Nup88 has been reported to promote the early step of tumorigenesis by inducing multinuclei in both HeLa cells
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique