Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU150591

Sigma-Aldrich

MISSION® esiRNA

targeting human CIITA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGACACAGACACCATCAACTGCGACCAGTTCAGCAGGCTGTTGTGTGACATGGAAGGTGATGAAGAGACCAGGGAGGCTTATGCCAATATCGCGGAACTGGACCAGTATGTCTTCCAGGACTCCCAGCTGGAGGGCCTGAGCAAGGACATTTTCAAGCACATAGGACCAGATGAAGTGATCGGTGAGAGTATGGAGATGCCAGCAGAAGTTGGGCAGAAAAGTCAGAAAAGACCCTTCCCAGAGGAGCTTCCGGCAGACCTGAAGCACTGGAAGCCAGCTGAGCCCCCCACTGTGGTGACTGGCAGTCTCCTAGTGAGACCAGTGAGCGACTGCTCCACCCTGCCCTGCCTGCCACTGCCTGCGCTGTTCAACCAGGAGCCAGCCTCCGGCCAGATGCGCCTGGAGAAAACCGACCAGATTCCCATGCCTTTCTCCAGTTCCTCGTTGAGCTGCCTGAATCTCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hiroaki Nagatomo et al.
The Japanese journal of veterinary research, 63(4), 159-171 (2016-01-13)
There has been no work on spatiotemporal transcriptomic differences of blastocysts using in vivo- and in vitro-derived, and somatic cell nuclear transfer (SCNT) embryos. Here, we first compared the lineage-differentially transcriptomic profiles of in vivo- and in vitro-derived embryos by
Shaylynn Miller et al.
Annals of the rheumatic diseases, 78(4), 519-528 (2019-01-25)
We examined genome-wide DNA methylation changes in CD8+ T cells from patients with lupus and controls and investigated the functional relevance of some of these changes in lupus. Genome-wide DNA methylation of lupus and age, sex and ethnicity-matched control CD8+

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique