Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU149801

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCAAGCAGTGGAGATGGATTTGAAGAAGGTCTGACTGTGGCCACAGTAGTGGAGTCAGCCCTTTGTGCTCTGAGAAATTGTATAGCCTTCATGCCCCCAGCGGAACAGAACCCGGCCCCCCTGGCCCAGCCAGAGCCTCTGGTGTGGGTCAGCAAGTGGGTTGACTACTCCAATAAGTTCGGCTTTGGGTATCAACTGTCCAGCCGCCGTGTGGCTGTGCTCTTCAACGATGGCACACATATGGCCCTGTCGGCCAACAGAAAGACTGTGCACTACAATCCCACCAGCACAAAGCACTTCTCCTTCTCCGTGGGTGCTGTGCCCCGGGCCCTGCAGCCTCAGCTGGGTATCCTGCGGTACTTCGCCTCCTACATGGAGCAGCACCTCATGAAGGGTGGAGATCTGCCCAGTGTGGAAGAGGTAGAGGTACCTGCTCCGCCCTTGCTGCTGCAGTGGGTCAAGACGGATCAGGCTCTCCTCATGCTGTTTAGTGATGGCACTGTCCAGGTGAACTTCTACGGGGACCAC

Numéro d'accès Ensembl | humain

ENSG00000173846

Numéro d'accès NCBI

NM_004073

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PLK3(1263) , PLK3(1263)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mahamat Babagana et al.
Molecular carcinogenesis, 59(1), 5-14 (2019-10-02)
The activation of oncogenic mitogen-activated protein kinase cascade via mutations in BRAF is often observed in human melanomas. Targeted inhibitors of BRAF (BRAFi), alone or as a part of a combination therapy, offer a significant benefit to such patients. Unfortunately
Cecilia Aquino Perez et al.
Cells, 9(6) (2020-06-25)
Polo-like kinases play essential roles in cell cycle control and mitosis. In contrast to other members of this kinase family, PLK3 has been reported to be activated upon cellular stress including DNA damage, hypoxia and osmotic stress. Here we knocked
Chellappagounder Thangavel et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(21), 5468-5482 (2014-08-29)
Perturbations in the retinoblastoma pathway are over-represented in advanced prostate cancer; retinoblastoma loss promotes bypass of first-line hormone therapy. Conversely, preliminary studies suggested that retinoblastoma-deficient tumors may become sensitized to a subset of DNA-damaging agents. Here, the molecular and in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique