Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU148691

Sigma-Aldrich

MISSION® esiRNA

targeting human ALOX5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGCAAGTACTGGCTGAATGACGACTGGTACCTGAAGTACATCACGCTGAAGACGCCCCACGGGGACTACATCGAGTTCCCCTGCTACCGCTGGATCACCGGCGATGTCGAGGTTGTCCTGAGGGATGGACGCGCAAAGTTGGCCCGAGATGACCAAATTCACATTCTCAAGCAACACCGACGTAAAGAACTGGAAACACGGCAAAAACAATATCGATGGATGGAGTGGAACCCTGGCTTCCCCTTGAGCATCGATGCCAAATGCCACAAGGATTTACCCCGTGATATCCAGTTTGATAGTGAAAAAGGAGTGGACTTTGTTCTGAATTACTCCAAAGCGATGGAGAACCTGTTCATCAACCGCTTCATGCACATGTTCCAGTCTTCTTGGAATGACTTCGCCGACTTTGAGAAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Alana N Vagnozzi et al.
Translational psychiatry, 7(12), 1288-1288 (2017-12-19)
Neurodegenerative tauopathies are characterized by pathological accumulation of highly phosphorylated isoforms of tau protein, which leads to progressive neuronal loss. Neuroinflammation often accompanies tau-driven diseases; however, the direct role of neuroinflammation in tauopathies remains unknown. The 5-lipoxygenase (5LO) is a
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Hyun Jeong Kwak et al.
Scientific reports, 7(1), 5025-5025 (2017-07-12)
Leukotriene B4 (LTB4) production via the 5-lipoxygenase (5-LO) pathway contributes to the development of insulin resistance in adipose and hepatic tissues, but the role of LTB4 in skeletal muscle is relatively unknown. Here, the authors investigated the role of LTB4
Seon Min Woo et al.
Oncotarget, 8(63), 106672-106684 (2018-01-02)
Cathepsin G is a serine protease secreted from activated neutrophils, it has important roles in inflammation and immune response. Moreover, cathepsin G promotes tumor cell-cell adhesion and migration in cancer cells. In this study, we investigated whether inhibition of cathepsin
Olga Scherer et al.
Journal of immunological methods, 422, 118-124 (2015-04-22)
Monocytes are an important constituent of the innate immune system. Therefore, manipulating gene expression of primary human monocytes is a crucial mean to study and characterize the functions of targeted proteins in monocytes. Gene silencing by transfection of cells with

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique