Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU147561

Sigma-Aldrich

MISSION® esiRNA

targeting human PKM

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTGATTCACCACCCATCACAGCCCGGAACACTGGCATCATCTGTACCATTGGCCCAGCTTCCCGATCAGTGGAGACGTTGAAGGAGATGATTAAGTCTGGAATGAATGTGGCTCGTCTGAACTTCTCTCATGGAACTCATGAGTACCATGCGGAGACCATCAAGAATGTGCGCACAGCCACGGAAAGCTTTGCTTCTGACCCCATCCTCTACCGGCCCGTTGCTGTGGCTCTAGACACTAAAGGACCTGAGATCCGAACTGGGCTCATCAAGGGCAGCGGCACTGCAGAGGTGGAGCTGAAGAAGGGAGCCACTCTCAAAATCACGCTGGATAACGCCTACATGGAAAAGTGTGACGAGAACATCCTGTGGCTGGACTACAAGAACATCTGCAAGGTGGTGGAAGTGGGCAGCAAGATCTACG

Numéro d'accès Ensembl | humain

ENSG00000067225

Numéro d'accès NCBI

NM_002654

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... PKM(5315) , PKM2(5315)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Pu-Hyeon Cha et al.
British journal of cancer, 124(3), 634-644 (2020-10-20)
Most cancer cells employ the Warburg effect to support anabolic growth and tumorigenesis. Here, we discovered a key link between Warburg effect and aberrantly activated Wnt/β-catenin signalling, especially by pathologically significant APC loss, in CRC. Proteomic analyses were performed to
Hai Hu et al.
Journal of Cancer, 11(8), 2022-2031 (2020-03-05)
Macrophages play a critical role in the initiation and progression in various human solid tumors; however, their role and transformation in pancreatic ductal adenocarcinoma (PDAC) were still illusive. Here, immunohistochemistry was used to determine CD206 (specific marker of M2 macrophage)
Guo-Bin Ding et al.
Polymers, 12(2) (2020-02-23)
Polyethylenimine (PEI) is a gold standard polymer with excellent transfection efficacy, yet its severe toxicity and nondegradability hinders its therapeutic application as a gene delivery vector. To tackle this problem, herein we incorporated the biodegradable polylactide (PLA) into the branched
Qingran Li et al.
Molecular & cellular proteomics : MCP, 17(8), 1531-1545 (2018-05-10)
Butyrate is a short chain fatty acid present in a high concentration in the gut lumen. It has been well documented that butyrate, by serving as an energetic metabolite, promotes the proliferation of normal colonocytes while, by serving as a
Ran Ao et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 42(5), 1769-1778 (2017-07-27)
This paper aims to explore the effects of pyruvate kinase (PK) M2 gene silencing on the proliferation and apoptosis of colorectal cancer (CRC) LS-147T and SW620 cells. CRC LS-147T and SW620 cells highly expressing PKM2 were randomly selected by quantitative
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique