Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU143071

Sigma-Aldrich

MISSION® esiRNA

targeting human BAG3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAGAAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTGGCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGCCCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCTCCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGGGGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCTGATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCCGAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGACCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Joseph M McClung et al.
Circulation, 136(3), 281-296 (2017-04-27)
Critical limb ischemia is a manifestation of peripheral artery disease that carries significant mortality and morbidity risk in humans, although its genetic determinants remain largely unknown. We previously discovered 2 overlapping quantitative trait loci in mice, We treated mice with
Patrick Antonietti et al.
Molecular cancer therapeutics, 16(1), 156-168 (2016-10-26)
Malignant gliomas exhibit a high intrinsic resistance against stimuli triggering apoptotic cell death. HSF1 acts as transcription factor upstream of HSP70 and the HSP70 co-chaperone BAG3 that is overexpressed in glioblastoma. To specifically target this resistance mechanism, we applied the
Fei Song et al.
Oncotarget, 8(56), 95392-95400 (2017-12-10)
Bcl2-associated athanogene 3 (BAG3) has been reported to be involved in aggressive progression of many tumors. In the present study, we examined the expression of BAG3 in human cervical cancer (CC) tissues and investigated the role of BAG3 in SiHa
Shuang Qiu et al.
Oncology reports, 38(1), 309-316 (2017-06-20)
Ovarian cancer is the most lethal disease among all gynecological malignancies. Interval cytoreductive surgery and cisplatin‑based chemotherapy are the recommended therapeutic strategies. However, acquired resistance to cisplatin remains a big challenge for the overall survival and prognosis in ovarian cancer.
Farzaneh G Tahrir et al.
Journal of cellular physiology, 232(4), 797-805 (2016-07-07)
Mitochondrial abnormalities impact the development of myofibrillar myopathies. Therefore, understanding the mechanisms underlying the removal of dysfunctional mitochondria from cells is of great importance toward understanding the molecular events involved in the genesis of cardiomyopathy. Earlier studies have ascribed a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique