Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU134341

Sigma-Aldrich

MISSION® esiRNA

targeting human RPN2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCCACTGAAGTTGGCATCACAAATGTTGATCTTTCCACCGTGGATAAGGATCAGAGCATTGCACCCAAAACTACCCGGGTGACATACCCAGCCAAAGCCAAGGGCACATTCATCGCAGACAGCCACCAGAACTTCGCCTTGTTCTTCCAGCTGGTAGATGTGAACACTGGTGCTGAACTCACTCCTCACCAGACATTTGTCCGACTCCATAACCAGAAGACTGGCCAGGAAGTGGTGTTTGTTGCCGAGCCAGACAACAAGAACGTGTACAAGTTTGAACTGGATACCTCTGAAAGAAAGATTGAATTTGACTCTGCCTCTGGCACCTACACTCTCTACTTAATCATTGGAGATGCCACTTTGAAGAACCCAATCCTCTGGAATGTGGCTGATGTGGTCATC

Numéro d'accès Ensembl | humain

ENSG00000118705

Numéro d'accès NCBI

NM_001135771

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RPN2(6185) , RPN2(6185)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Jinhai Ren et al.
Experimental biology and medicine (Maywood, N.J.), 245(12), 1009-1015 (2020-05-26)
This study explored the role of ribophorin II (RPN2) in myelodysplastic syndromes (MDSs) cell proliferation and growth and revealed that RPN2 knockdown suppressed OCI-AML3 cell growth and proliferation and triggered cell cycle arrest and elicited apoptosis in OCI-AML3 cells. In
Jikui Sun et al.
Cell death & disease, 11(10), 890-890 (2020-10-23)
Accumulating evidence indicates that the dysregulation of the miRNAs/mRNA-mediated carcinogenic signaling pathway network is intimately involved in glioma initiation and progression. In the present study, by performing experiments and bioinformatics analysis, we found that RPN2 was markedly elevated in glioma
Gabriela Vazquez Rodriguez et al.
Frontiers in oncology, 10, 598684-598684 (2020-12-18)
The majority of estrogen receptor positive (ER+) breast cancer (BC) maintain the ER at metastatic sites. Despite anti-estrogen therapy, almost 30% of ER+ BC patients relapse. Thus, new therapeutic targets for ER+ BC are needed. Amino acids (AAs) may affect

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique