Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU131401

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCCAAACTGCAACAAGAATGGATTTTATCACAGCAGACAGTGTGAGACATCCATGGATGGAGAGGCGGGACTCTGCTGGTGCGTCTACCCTTGGAATGGGAAGAGGATCCCTGGGTCTCCAGAGATCAGGGGAGACCCCAACTGCCAGATATATTTTAATGTACAAAACTGAAACCAGATGAAATAATGTTCTGTCACGTGAAATATTTAAGTATATAGTATATTTATACTCTAGAACATGCACATTTATATATATATGTATATGTATATATATATAGTAACTACTTTTTATACTCCATACATAACTTGATATAGAAAGCTGTTTATTTATTCACTGTAAGTTTATTTTTTCTACACAGTAAAAACTTGTACTATGTTAATAACTTGTCCTATGTCAATTTGTATATCATGAAACACTTCTCATCATATTGTATGTAAGTAATTGCATTTCTGCTCTTCCAAAGCTCC

Numéro d'accès Ensembl | humain

ENSG00000146678

Numéro d'accès NCBI

NM_000596

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... IGFBP1(3484) , IGFBP1(3484)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Fang Zheng et al.
Experimental & molecular medicine, 50(9), 121-121 (2018-09-14)
β-Elemene, an active component of natural plants, has been shown to exhibit anticancer properties. However, the detailed mechanism underlying these effects has yet to be determined. In this study, we show that β-elemene inhibits the growth of lung cancer cells.
Hideno Tochigi et al.
Scientific reports, 7, 40001-40001 (2017-01-05)
Endometrial decidualization represents an essential step for the successful implantation of the embryo; however, the molecular mechanism behind this differentiation process remains unclear. This study aimed to identify novel microRNAs (miRNAs) involved in the regulation of decidual gene expression in
Ali Vaziri-Gohar et al.
Molecular and cellular endocrinology, 422, 160-171 (2015-12-23)
Tamoxifen, a selective estrogen receptor modulator, is a commonly prescribed adjuvant therapy for estrogen receptor-α (ERα)-positive breast cancer patients. To determine if extracellular factors contribute to the modulation of IGF-1 signaling after tamoxifen treatment, MCF-7 cells were treated with IGF-1 in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique